CU126147 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTTTGGAAAAAGATTGTAGGAAATTCCTGAGGAACGACGACATAGACTTTTACACCTCCTAACCCCTAGGTGCATATCAAGGGCTTGGGGAATTGCTGGCACGCGATATGAGGATCCAAAGTTAGTTAAAAAAACGGCATCTAGTTTGCTGCAAAATGAAGATGCATGGTGCTTGAATATTATAACTG
BLAST of CU126147 vs. NCBI nr
Match: gi|700190193|gb|KGN45426.1| (hypothetical protein Csa_7G447880 [Cucumis sativus]) HSP 1 Score: 69.3 bits (168), Expect = 2.6e-09 Identity = 32/35 (91.43%), Postives = 32/35 (91.43%), Query Frame = 3
BLAST of CU126147 vs. NCBI nr
Match: gi|778729487|ref|XP_004141740.2| (PREDICTED: uncharacterized protein LOC101213828 [Cucumis sativus]) HSP 1 Score: 69.3 bits (168), Expect = 2.6e-09 Identity = 32/35 (91.43%), Postives = 32/35 (91.43%), Query Frame = 3
BLAST of CU126147 vs. NCBI nr
Match: gi|659124553|ref|XP_008462224.1| (PREDICTED: uncharacterized protein LOC103500630 [Cucumis melo]) HSP 1 Score: 65.5 bits (158), Expect = 3.8e-08 Identity = 30/35 (85.71%), Postives = 31/35 (88.57%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|