CU126074 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAGGTTTCAAAGTTCTCACAATTCCTTTTGTCCTTTTCGAATTTCAATCGTATGGGGAATTGGAGAAGACGATACGGCTCTGAAATTCCTCATCATCAGCTACTCAAATCCCCCAGAAACCCCTCTCCAGATAATTGGCACGCTGGTGCGCCGTCGTGGG
BLAST of CU126074 vs. TrEMBL
Match: A0A0A0LC07_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G824170 PE=4 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 9.9e-15 Identity = 35/36 (97.22%), Postives = 35/36 (97.22%), Query Frame = 3
BLAST of CU126074 vs. NCBI nr
Match: gi|449437803|ref|XP_004136680.1| (PREDICTED: uncharacterized protein LOC101209753 [Cucumis sativus]) HSP 1 Score: 86.3 bits (212), Expect = 1.9e-14 Identity = 35/36 (97.22%), Postives = 35/36 (97.22%), Query Frame = 3
BLAST of CU126074 vs. NCBI nr
Match: gi|659085315|ref|XP_008443354.1| (PREDICTED: uncharacterized protein DDB_G0287625 isoform X1 [Cucumis melo]) HSP 1 Score: 80.1 bits (196), Expect = 1.3e-12 Identity = 32/36 (88.89%), Postives = 33/36 (91.67%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|