CU126000 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGCCGGGGCACACTCCGCGCCCTCGCTCTCATTTTTCCCCCAAATCGATAGACTTTTGAATTGGAATTTCATTTCTCTATGAGGACCGGAATGCGGTACCACGCCGGCGGTGAGGATCACCGGCGGGAGTCTCATTTTCTTGAAGCTTGTTTTCTCTGCCGGAGGCCGCTCGGATTCAACCGAGACATTTTCATGTACAAAGGAAACACGCCGTTCTGTAGCAAAGAATGCCGGCAGGAACAGATTGAGATC
BLAST of CU126000 vs. TrEMBL
Match: A0A0A0LHK0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G118280 PE=4 SV=1) HSP 1 Score: 130.6 bits (327), Expect = 9.1e-28 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = 1
BLAST of CU126000 vs. TrEMBL
Match: A0A0B2QHL3_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_046293 PE=4 SV=1) HSP 1 Score: 104.8 bits (260), Expect = 5.4e-20 Identity = 46/59 (77.97%), Postives = 51/59 (86.44%), Query Frame = 1
BLAST of CU126000 vs. TrEMBL
Match: K7KE91_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_03G105400 PE=4 SV=1) HSP 1 Score: 104.8 bits (260), Expect = 5.4e-20 Identity = 46/59 (77.97%), Postives = 51/59 (86.44%), Query Frame = 1
BLAST of CU126000 vs. TrEMBL
Match: C6SZ02_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_07G117300 PE=2 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.2e-19 Identity = 46/59 (77.97%), Postives = 51/59 (86.44%), Query Frame = 1
BLAST of CU126000 vs. TrEMBL
Match: A0A0B2P1P9_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_034403 PE=4 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.2e-19 Identity = 46/59 (77.97%), Postives = 51/59 (86.44%), Query Frame = 1
BLAST of CU126000 vs. NCBI nr
Match: gi|700206286|gb|KGN61405.1| (hypothetical protein Csa_2G118280 [Cucumis sativus]) HSP 1 Score: 133.3 bits (334), Expect = 2.0e-28 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = 1
BLAST of CU126000 vs. NCBI nr
Match: gi|734371916|gb|KHN19719.1| (hypothetical protein glysoja_046293 [Glycine soja]) HSP 1 Score: 107.5 bits (267), Expect = 1.2e-20 Identity = 46/59 (77.97%), Postives = 51/59 (86.44%), Query Frame = 1
BLAST of CU126000 vs. NCBI nr
Match: gi|1009159502|ref|XP_015897849.1| (PREDICTED: uncharacterized protein LOC107431453 [Ziziphus jujuba]) HSP 1 Score: 107.1 bits (266), Expect = 1.6e-20 Identity = 46/58 (79.31%), Postives = 51/58 (87.93%), Query Frame = 1
BLAST of CU126000 vs. NCBI nr
Match: gi|351721079|ref|NP_001235150.1| (uncharacterized protein LOC100499981 [Glycine max]) HSP 1 Score: 106.3 bits (264), Expect = 2.6e-20 Identity = 46/59 (77.97%), Postives = 51/59 (86.44%), Query Frame = 1
BLAST of CU126000 vs. NCBI nr
Match: gi|351726528|ref|NP_001235594.1| (uncharacterized protein LOC100306220 [Glycine max]) HSP 1 Score: 105.5 bits (262), Expect = 4.5e-20 Identity = 45/59 (76.27%), Postives = 51/59 (86.44%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|