CU125744 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTAAGAGGGATGCGTGAGGCTGCAAAATGGAGAAAATCACAAGGAATATCTATGGAGGGTGATGAAGAACTCCTTGCCAACATGGATGATGAAGTTACAGCAGAACCCAAAAGAGATGAATGGATGACCAGCCTACCTCCTGAAAGAAAGCCTGGCATGACTATGCAGTCTTCTAGATTCAGCAAGAGCTCCAAGGAAAGTCGTGGTGATACAAGTGTTTGACT
BLAST of CU125744 vs. TrEMBL
Match: A0A0A0K9B3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G280860 PE=4 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 2.2e-25 Identity = 60/73 (82.19%), Postives = 61/73 (83.56%), Query Frame = 1
BLAST of CU125744 vs. TrEMBL
Match: A5AXU1_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_18s0072g01080 PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.3e-17 Identity = 49/73 (67.12%), Postives = 54/73 (73.97%), Query Frame = 1
BLAST of CU125744 vs. TrEMBL
Match: A0A0D2SDV1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_013G140400 PE=4 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 6.4e-17 Identity = 48/73 (65.75%), Postives = 54/73 (73.97%), Query Frame = 1
BLAST of CU125744 vs. TrEMBL
Match: A0A0D2VF33_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_013G140400 PE=4 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 6.4e-17 Identity = 48/73 (65.75%), Postives = 54/73 (73.97%), Query Frame = 1
BLAST of CU125744 vs. TrEMBL
Match: A0A0D2VDJ4_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_013G140400 PE=4 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 6.4e-17 Identity = 48/73 (65.75%), Postives = 54/73 (73.97%), Query Frame = 1
BLAST of CU125744 vs. NCBI nr
Match: gi|449465354|ref|XP_004150393.1| (PREDICTED: uncharacterized protein LOC101213388 [Cucumis sativus]) HSP 1 Score: 120.6 bits (301), Expect = 1.2e-24 Identity = 60/73 (82.19%), Postives = 61/73 (83.56%), Query Frame = 1
BLAST of CU125744 vs. NCBI nr
Match: gi|700189173|gb|KGN44406.1| (hypothetical protein Csa_7G280860 [Cucumis sativus]) HSP 1 Score: 120.6 bits (301), Expect = 1.2e-24 Identity = 60/73 (82.19%), Postives = 61/73 (83.56%), Query Frame = 1
BLAST of CU125744 vs. NCBI nr
Match: gi|659124015|ref|XP_008461948.1| (PREDICTED: microtubule-associated protein futsch [Cucumis melo]) HSP 1 Score: 120.2 bits (300), Expect = 1.6e-24 Identity = 59/73 (80.82%), Postives = 61/73 (83.56%), Query Frame = 1
BLAST of CU125744 vs. NCBI nr
Match: gi|225460732|ref|XP_002267868.1| (PREDICTED: uncharacterized protein LOC100255442 [Vitis vinifera]) HSP 1 Score: 95.1 bits (235), Expect = 5.4e-17 Identity = 49/73 (67.12%), Postives = 54/73 (73.97%), Query Frame = 1
BLAST of CU125744 vs. NCBI nr
Match: gi|823262886|ref|XP_012464204.1| (PREDICTED: calponin homology domain-containing protein DDB_G0272472 [Gossypium raimondii]) HSP 1 Score: 92.8 bits (229), Expect = 2.7e-16 Identity = 48/73 (65.75%), Postives = 54/73 (73.97%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|