CU125708 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGCTTCTTCTTCTGCACTAGCTTGAACAAAAATACAGAAGTTTGATCCAAACTAATCCAATGGATACGAAGCACAAAGAAATGCAGTTCCTTGGAGCCTTCCGAATCTTCAAAGAAACCTACAAAATTATCAGCAAAAACAAAAAGATATTTGCCATGGCAGCTCTTTGCTTCATCCACCCTCTAAACTTCGTTCTTTCAGGCTTAATGTTGACCTTGAATAACATCCTAAGAAACCTCCACGATTATGGGAAT
BLAST of CU125708 vs. TrEMBL
Match: A0A0A0KJQ4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G421800 PE=4 SV=1) HSP 1 Score: 135.2 bits (339), Expect = 3.8e-29 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 1
BLAST of CU125708 vs. NCBI nr
Match: gi|700192782|gb|KGN47986.1| (hypothetical protein Csa_6G421800 [Cucumis sativus]) HSP 1 Score: 133.3 bits (334), Expect = 2.1e-28 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 1
BLAST of CU125708 vs. NCBI nr
Match: gi|659128751|ref|XP_008464353.1| (PREDICTED: uncharacterized protein LOC103502262 [Cucumis melo]) HSP 1 Score: 122.5 bits (306), Expect = 3.7e-25 Identity = 58/65 (89.23%), Postives = 62/65 (95.38%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|