CU125644 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CACAAACAGCTGCACTGATGAGTATTTCCAGTGGCTGGACTCCCAAACAGAGTGCTCTGTTTTGTACATTTCACAGGGGAGTTTTCTTTCAGTTTCAAGCTCTCAAATGGAGGAGATCGTCGCCGGGGTGAAAGCCAGCGGTGTCCGGTTCTTGTGGGTGGCGCGTGGGAATGACGGCCGGTTGAAGGACGTGGATAGAGAAAATGGGGGTGGTGGTTCGATGGTGCGACCAGTTGAAGGTTCTGTGCCATA
BLAST of CU125644 vs. Swiss-Prot
Match: U87A1_ARATH (UDP-glycosyltransferase 87A1 OS=Arabidopsis thaliana GN=UGT87A1 PE=2 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 5.5e-10 Identity = 30/57 (52.63%), Postives = 36/57 (63.16%), Query Frame = 2
HSP 2 Score: 35.8 bits (81), Expect = 2.7e-01 Identity = 13/16 (81.25%), Postives = 13/16 (81.25%), Query Frame = 3
BLAST of CU125644 vs. Swiss-Prot
Match: U87A2_ARATH (UDP-glycosyltransferase 87A2 OS=Arabidopsis thaliana GN=UGT87A2 PE=1 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.6e-09 Identity = 31/56 (55.36%), Postives = 35/56 (62.50%), Query Frame = 2
HSP 2 Score: 35.8 bits (81), Expect = 2.7e-01 Identity = 13/16 (81.25%), Postives = 13/16 (81.25%), Query Frame = 3
BLAST of CU125644 vs. TrEMBL
Match: A0A0A0KF85_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G181570 PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 1.3e-23 Identity = 57/69 (82.61%), Postives = 57/69 (82.61%), Query Frame = 2
BLAST of CU125644 vs. TrEMBL
Match: A0A0A0KF85_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G181570 PE=4 SV=1) HSP 1 Score: 40.8 bits (94), Expect = 9.4e-01 Identity = 16/17 (94.12%), Postives = 17/17 (100.00%), Query Frame = 3
HSP 2 Score: 88.6 bits (218), Expect = 3.9e-15 Identity = 44/68 (64.71%), Postives = 50/68 (73.53%), Query Frame = 2
BLAST of CU125644 vs. TrEMBL
Match: A0A0A0KH18_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G181560 PE=4 SV=1) HSP 1 Score: 33.5 bits (75), Expect = 1.5e+02 Identity = 12/15 (80.00%), Postives = 14/15 (93.33%), Query Frame = 3
HSP 2 Score: 71.2 bits (173), Expect = 6.5e-10 Identity = 36/62 (58.06%), Postives = 40/62 (64.52%), Query Frame = 2
BLAST of CU125644 vs. TrEMBL
Match: A0A0J8BZE0_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_7g175160 PE=4 SV=1) HSP 1 Score: 34.7 bits (78), Expect = 6.7e+01 Identity = 14/28 (50.00%), Postives = 20/28 (71.43%), Query Frame = 3
HSP 2 Score: 70.5 bits (171), Expect = 1.1e-09 Identity = 37/63 (58.73%), Postives = 41/63 (65.08%), Query Frame = 2
BLAST of CU125644 vs. TrEMBL
Match: B9GH66_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0001s28890g PE=4 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 4.2e-09 Identity = 33/64 (51.56%), Postives = 43/64 (67.19%), Query Frame = 2
BLAST of CU125644 vs. NCBI nr
Match: gi|778713759|ref|XP_004143221.2| (PREDICTED: UDP-glycosyltransferase 87A1-like [Cucumis sativus]) HSP 1 Score: 117.1 bits (292), Expect = 1.5e-23 Identity = 57/69 (82.61%), Postives = 57/69 (82.61%), Query Frame = 2
BLAST of CU125644 vs. NCBI nr
Match: gi|659130645|ref|XP_008465275.1| (PREDICTED: UDP-glycosyltransferase 87A1-like [Cucumis melo]) HSP 1 Score: 102.4 bits (254), Expect = 3.8e-19 Identity = 49/68 (72.06%), Postives = 52/68 (76.47%), Query Frame = 2
BLAST of CU125644 vs. NCBI nr
Match: gi|449450838|ref|XP_004143169.1| (PREDICTED: UDP-glycosyltransferase 87A1-like [Cucumis sativus]) HSP 1 Score: 89.0 bits (219), Expect = 4.3e-15 Identity = 44/68 (64.71%), Postives = 50/68 (73.53%), Query Frame = 2
BLAST of CU125644 vs. NCBI nr
Match: gi|659127700|ref|XP_008463842.1| (PREDICTED: UDP-glycosyltransferase 87A1-like [Cucumis melo]) HSP 1 Score: 87.0 bits (214), Expect = 1.6e-14 Identity = 41/68 (60.29%), Postives = 51/68 (75.00%), Query Frame = 2
BLAST of CU125644 vs. NCBI nr
Match: gi|731349246|ref|XP_010685898.1| (PREDICTED: UDP-glycosyltransferase 87A2-like [Beta vulgaris subsp. vulgaris]) HSP 1 Score: 71.6 bits (174), Expect = 7.1e-10 Identity = 36/62 (58.06%), Postives = 40/62 (64.52%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|