CU125445 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGCATTGTGGATACTATATTCTTCTTTCAAATATATATGCAGAAACAGGAAGGTGGGATGAGGCAAACAAAATTAGGGAACTGATGAAGTCTAGGGGAGCCAAAAAGAACCCTGGCTGTAGTTGGGTCCAAATTTATGACCAAGTGCAT
BLAST of CU125445 vs. Swiss-Prot
Match: PP271_ARATH (Putative pentatricopeptide repeat-containing protein At3g49142 OS=Arabidopsis thaliana GN=PCMP-H77 PE=3 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 1.1e-10 Identity = 28/47 (59.57%), Postives = 34/47 (72.34%), Query Frame = 3
BLAST of CU125445 vs. Swiss-Prot
Match: PP229_ARATH (Pentatricopeptide repeat-containing protein At3g14330 OS=Arabidopsis thaliana GN=PCMP-H57 PE=2 SV=2) HSP 1 Score: 66.2 bits (160), Expect = 1.1e-10 Identity = 26/46 (56.52%), Postives = 33/46 (71.74%), Query Frame = 3
BLAST of CU125445 vs. Swiss-Prot
Match: PPR53_ARATH (Pentatricopeptide repeat-containing protein At1g20230 OS=Arabidopsis thaliana GN=PCMP-H21 PE=2 SV=2) HSP 1 Score: 64.7 bits (156), Expect = 3.2e-10 Identity = 27/47 (57.45%), Postives = 33/47 (70.21%), Query Frame = 3
BLAST of CU125445 vs. Swiss-Prot
Match: PPR57_ARATH (Pentatricopeptide repeat-containing protein At1g25360 OS=Arabidopsis thaliana GN=PCMP-H74 PE=2 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 5.5e-10 Identity = 25/49 (51.02%), Postives = 35/49 (71.43%), Query Frame = 3
BLAST of CU125445 vs. Swiss-Prot
Match: PP147_ARATH (Pentatricopeptide repeat-containing protein At2g03880, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H44 PE=2 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 7.2e-10 Identity = 25/47 (53.19%), Postives = 32/47 (68.09%), Query Frame = 3
BLAST of CU125445 vs. TrEMBL
Match: A0A0A0KEH6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G428560 PE=4 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 5.7e-22 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = 3
BLAST of CU125445 vs. TrEMBL
Match: A0A072UUM5_MEDTR (Pentatricopeptide (PPR) repeat protein OS=Medicago truncatula GN=MTR_3g045450 PE=4 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 4.5e-19 Identity = 44/49 (89.80%), Postives = 46/49 (93.88%), Query Frame = 3
BLAST of CU125445 vs. TrEMBL
Match: A0A0R0E6Q8_SOYBN (Uncharacterized protein (Fragment) OS=Glycine max GN=GLYMA_20G044000 PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 2.9e-18 Identity = 43/49 (87.76%), Postives = 46/49 (93.88%), Query Frame = 3
BLAST of CU125445 vs. TrEMBL
Match: K7N1H5_SOYBN (Uncharacterized protein OS=Glycine max PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 2.9e-18 Identity = 43/49 (87.76%), Postives = 46/49 (93.88%), Query Frame = 3
BLAST of CU125445 vs. TrEMBL
Match: A0A151UEI8_CAJCA (Putative pentatricopeptide repeat-containing protein At3g49140 family (Fragment) OS=Cajanus cajan GN=KK1_050377 PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 2.9e-18 Identity = 43/49 (87.76%), Postives = 45/49 (91.84%), Query Frame = 3
BLAST of CU125445 vs. NCBI nr
Match: gi|449445027|ref|XP_004140275.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g14170 [Cucumis sativus]) HSP 1 Score: 112.5 bits (280), Expect = 2.2e-22 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = 3
BLAST of CU125445 vs. NCBI nr
Match: gi|659097428|ref|XP_008449620.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At1g69350, mitochondrial [Cucumis melo]) HSP 1 Score: 107.8 bits (268), Expect = 5.3e-21 Identity = 47/49 (95.92%), Postives = 48/49 (97.96%), Query Frame = 3
BLAST of CU125445 vs. NCBI nr
Match: gi|922378529|ref|XP_013459503.1| (pentatricopeptide (PPR) repeat protein [Medicago truncatula]) HSP 1 Score: 102.8 bits (255), Expect = 1.7e-19 Identity = 44/49 (89.80%), Postives = 46/49 (93.88%), Query Frame = 3
BLAST of CU125445 vs. NCBI nr
Match: gi|947040000|gb|KRG89724.1| (hypothetical protein GLYMA_20G044000, partial [Glycine max]) HSP 1 Score: 100.1 bits (248), Expect = 1.1e-18 Identity = 43/49 (87.76%), Postives = 46/49 (93.88%), Query Frame = 3
BLAST of CU125445 vs. NCBI nr
Match: gi|1012366519|gb|KYP77700.1| (Putative pentatricopeptide repeat-containing protein At3g49140 family, partial [Cajanus cajan]) HSP 1 Score: 100.1 bits (248), Expect = 1.1e-18 Identity = 43/49 (87.76%), Postives = 45/49 (91.84%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|