CU125199 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGACACTGATCAAATCACAAAACACAATATGCCGCCATTCTCTAATCTTTCATCCCTCTCTCTGGCCTATCGATCCTCCCTCGCCCGCATTCACTCTCCAGTCACCGGCGTCTTCCCCATCTTGAAATGTGCTTCTTCTTTTCACCGGCACCACCCGCCAACTGCTTCTGTCCCATTTCAACATGTGCATTATCATTCCGTGTTTCAAGACGAACGCAAAAGGGATGAGTGGA
BLAST of CU125199 vs. NCBI nr
Match: gi|778671200|ref|XP_004152791.2| (PREDICTED: serpin-ZX-like [Cucumis sativus]) HSP 1 Score: 112.1 bits (279), Expect = 4.5e-22 Identity = 52/68 (76.47%), Postives = 52/68 (76.47%), Query Frame = 3
BLAST of CU125199 vs. NCBI nr
Match: gi|659087829|ref|XP_008444656.1| (PREDICTED: serpin-ZX-like [Cucumis melo]) HSP 1 Score: 79.0 bits (193), Expect = 4.3e-12 Identity = 34/40 (85.00%), Postives = 37/40 (92.50%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|