CU124852 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTCCGAGAGGAGAAAGTCTCTATAGAAATGGTGTTAATTACATCAACTCTGCATTCACAGTTTGCTCGAACAACTCTATACACAATATCTCCACAATCTAAGCCGGGGTCTTCTGTAATGAATGCGGTACATAGATATTTGTAGTGCTTTTGAGGTTGAGGAAGTTGGCGTCGGTACTTGGTGACAGAATCCCAGACATAATAATGTTTAGGGTGACGACCGCAGAGAAGAAGCCCATCA
BLAST of CU124852 vs. Swiss-Prot
Match: FB251_ARATH (F-box protein At5g03970 OS=Arabidopsis thaliana GN=At5g03970 PE=2 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 5.9e-14 Identity = 39/79 (49.37%), Postives = 51/79 (64.56%), Query Frame = -2
BLAST of CU124852 vs. TrEMBL
Match: A0A0A0LJ78_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G010130 PE=4 SV=1) HSP 1 Score: 174.1 bits (440), Expect = 6.8e-41 Identity = 79/79 (100.00%), Postives = 79/79 (100.00%), Query Frame = -2
BLAST of CU124852 vs. TrEMBL
Match: A0A061F904_THECC (F-box associated ubiquitination effector family protein, putative OS=Theobroma cacao GN=TCM_026258 PE=4 SV=1) HSP 1 Score: 97.8 bits (242), Expect = 6.2e-18 Identity = 46/79 (58.23%), Postives = 58/79 (73.42%), Query Frame = -2
BLAST of CU124852 vs. TrEMBL
Match: A0A0B0MMB6_GOSAR (Uncharacterized protein OS=Gossypium arboreum GN=F383_17408 PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.4e-17 Identity = 44/79 (55.70%), Postives = 58/79 (73.42%), Query Frame = -2
BLAST of CU124852 vs. TrEMBL
Match: A0A0D2RAE1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_004G248800 PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.0e-16 Identity = 43/79 (54.43%), Postives = 57/79 (72.15%), Query Frame = -2
BLAST of CU124852 vs. TrEMBL
Match: A0A067DMU2_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g0151482mg PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 4.4e-16 Identity = 41/79 (51.90%), Postives = 58/79 (73.42%), Query Frame = -2
BLAST of CU124852 vs. NCBI nr
Match: gi|778666414|ref|XP_011648736.1| (PREDICTED: F-box protein At5g03970 isoform X2 [Cucumis sativus]) HSP 1 Score: 176.0 bits (445), Expect = 2.6e-41 Identity = 79/79 (100.00%), Postives = 79/79 (100.00%), Query Frame = -2
BLAST of CU124852 vs. NCBI nr
Match: gi|778666410|ref|XP_004139251.2| (PREDICTED: F-box protein At5g03970 isoform X1 [Cucumis sativus]) HSP 1 Score: 176.0 bits (445), Expect = 2.6e-41 Identity = 79/79 (100.00%), Postives = 79/79 (100.00%), Query Frame = -2
BLAST of CU124852 vs. NCBI nr
Match: gi|700205658|gb|KGN60777.1| (hypothetical protein Csa_2G010130 [Cucumis sativus]) HSP 1 Score: 176.0 bits (445), Expect = 2.6e-41 Identity = 79/79 (100.00%), Postives = 79/79 (100.00%), Query Frame = -2
BLAST of CU124852 vs. NCBI nr
Match: gi|659070719|ref|XP_008456330.1| (PREDICTED: F-box protein At5g03970 [Cucumis melo]) HSP 1 Score: 172.9 bits (437), Expect = 2.2e-40 Identity = 77/79 (97.47%), Postives = 78/79 (98.73%), Query Frame = -2
BLAST of CU124852 vs. NCBI nr
Match: gi|590642345|ref|XP_007030492.1| (F-box associated ubiquitination effector family protein, putative [Theobroma cacao]) HSP 1 Score: 99.4 bits (246), Expect = 3.0e-18 Identity = 46/79 (58.23%), Postives = 58/79 (73.42%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|