CU124805 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGAAAGAAAAAAAGGAGAAAAATCCTGCTAGTTGTGCAGGAAAGCCTCCCCCTTCCGTGATCGGGTTCTTTTGTCGTCGGTAAGCAAGCCGCCGAAGAAAGTTGGGGTGGTTTGCAGCAACCAAAACCCACTCTTCGCACACCCCTAACTCCTTCCTCTCTTTACCAATATTCATTTCAATGCCCCTGCCGGTTTCTTCAGTCTCTACCTACCTACTATGTTATTTTTAACTCTGTAGTGTAGACTTGAAATGGTGGCCATACTCAGCTGATC
BLAST of CU124805 vs. TrEMBL
Match: A0A0A0M182_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G542420 PE=4 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 1.3e-11 Identity = 37/49 (75.51%), Postives = 40/49 (81.63%), Query Frame = -3
BLAST of CU124805 vs. TrEMBL
Match: A0A0A0M182_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G542420 PE=4 SV=1) HSP 1 Score: 42.7 bits (99), Expect = 2.8e-01 Identity = 21/33 (63.64%), Postives = 23/33 (69.70%), Query Frame = -1
BLAST of CU124805 vs. NCBI nr
Match: gi|700210855|gb|KGN65951.1| (hypothetical protein Csa_1G542420 [Cucumis sativus]) HSP 1 Score: 79.3 bits (194), Expect = 3.8e-12 Identity = 37/49 (75.51%), Postives = 40/49 (81.63%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|