CU124451 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCACCACATAGCTTCTTCTGCCTGCAGAAATGGCAACAGATTCCAAAAACAGGATCATAAACGCCCCCTCGTCCCTTACTATTACACCTCCGTGCCGACGCATCCGGCGAAGTCCAATGTTCCGAATTACTAATCTTCACTAAAGGAGCATTCGCAGGCCGATTCACAACCTCTCCCTCCACTTCATTACAGTCTAGAACTAATTTCCTCTTCAGTCTGTCGGACCTCCGGAAGGAAATCTGGCAACG
BLAST of CU124451 vs. TrEMBL
Match: A0A0A0LQX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042940 PE=4 SV=1) HSP 1 Score: 176.8 bits (447), Expect = 1.1e-41 Identity = 82/83 (98.80%), Postives = 82/83 (98.80%), Query Frame = -1
BLAST of CU124451 vs. TrEMBL
Match: A0A067KIE9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_11902 PE=4 SV=1) HSP 1 Score: 99.8 bits (247), Expect = 1.7e-18 Identity = 51/77 (66.23%), Postives = 56/77 (72.73%), Query Frame = -1
BLAST of CU124451 vs. TrEMBL
Match: A0A059AV03_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H00548 PE=4 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.9e-17 Identity = 42/54 (77.78%), Postives = 46/54 (85.19%), Query Frame = -1
BLAST of CU124451 vs. TrEMBL
Match: A0A0R0IJV6_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_09G173700 PE=4 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 4.2e-17 Identity = 47/79 (59.49%), Postives = 58/79 (73.42%), Query Frame = -1
BLAST of CU124451 vs. TrEMBL
Match: I1L438_SOYBN (Uncharacterized protein OS=Glycine max PE=4 SV=2) HSP 1 Score: 95.1 bits (235), Expect = 4.2e-17 Identity = 47/79 (59.49%), Postives = 58/79 (73.42%), Query Frame = -1
BLAST of CU124451 vs. NCBI nr
Match: gi|449439477|ref|XP_004137512.1| (PREDICTED: cell division cycle-associated protein 7 [Cucumis sativus]) HSP 1 Score: 177.6 bits (449), Expect = 9.2e-42 Identity = 82/83 (98.80%), Postives = 82/83 (98.80%), Query Frame = -1
BLAST of CU124451 vs. NCBI nr
Match: gi|659066900|ref|XP_008466442.1| (PREDICTED: cell division cycle-associated protein 7-like [Cucumis melo]) HSP 1 Score: 162.9 bits (411), Expect = 2.4e-37 Identity = 77/83 (92.77%), Postives = 77/83 (92.77%), Query Frame = -1
BLAST of CU124451 vs. NCBI nr
Match: gi|802621118|ref|XP_012075847.1| (PREDICTED: cell division cycle-associated 7-like protein isoform X2 [Jatropha curcas]) HSP 1 Score: 100.1 bits (248), Expect = 1.9e-18 Identity = 51/77 (66.23%), Postives = 56/77 (72.73%), Query Frame = -1
BLAST of CU124451 vs. NCBI nr
Match: gi|802621115|ref|XP_012075846.1| (PREDICTED: uncharacterized protein LOC105637061 isoform X1 [Jatropha curcas]) HSP 1 Score: 100.1 bits (248), Expect = 1.9e-18 Identity = 51/77 (66.23%), Postives = 56/77 (72.73%), Query Frame = -1
BLAST of CU124451 vs. NCBI nr
Match: gi|1009133255|ref|XP_015883801.1| (PREDICTED: cell division cycle-associated protein 7-like [Ziziphus jujuba]) HSP 1 Score: 99.8 bits (247), Expect = 2.4e-18 Identity = 54/98 (55.10%), Postives = 64/98 (65.31%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|