CU124320 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGACAACCACAAGCAGATCAAAACAGATCACAGAGAAATATAGATATGGAGAATCGTTCTTACGAACCTGAAAAACCGCCAAAGATGTCTCACTGCAAGAACTCAGAGACAGACTCGCAGAGTTCGCTCGAGTTCGAGGATGGGAGCAGTACCACAGCCCTAGAAACCTGCTTCTAGCACTTGTTGGTGAAGTCGGAGAGCTATCGGAGATATTCCAG
BLAST of CU124320 vs. TrEMBL
Match: A0A0A0LP76_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G011520 PE=4 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 8.7e-11 Identity = 37/49 (75.51%), Postives = 37/49 (75.51%), Query Frame = 3
BLAST of CU124320 vs. TrEMBL
Match: A0A068V3C8_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00040767001 PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.1e-09 Identity = 34/49 (69.39%), Postives = 36/49 (73.47%), Query Frame = 3
BLAST of CU124320 vs. TrEMBL
Match: F6GT53_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_17s0000g06750 PE=4 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.8e-09 Identity = 34/49 (69.39%), Postives = 35/49 (71.43%), Query Frame = 3
BLAST of CU124320 vs. TrEMBL
Match: W9SJ40_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_015233 PE=4 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.8e-09 Identity = 34/49 (69.39%), Postives = 35/49 (71.43%), Query Frame = 3
BLAST of CU124320 vs. TrEMBL
Match: M5X029_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa013150mg PE=4 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 4.8e-09 Identity = 33/49 (67.35%), Postives = 36/49 (73.47%), Query Frame = 3
BLAST of CU124320 vs. NCBI nr
Match: gi|659106023|ref|XP_008453231.1| (PREDICTED: dCTP pyrophosphatase 1-like [Cucumis melo]) HSP 1 Score: 74.3 bits (181), Expect = 9.6e-11 Identity = 37/49 (75.51%), Postives = 37/49 (75.51%), Query Frame = 3
BLAST of CU124320 vs. NCBI nr
Match: gi|449440820|ref|XP_004138182.1| (PREDICTED: dCTP pyrophosphatase 1-like [Cucumis sativus]) HSP 1 Score: 74.3 bits (181), Expect = 9.6e-11 Identity = 37/49 (75.51%), Postives = 37/49 (75.51%), Query Frame = 3
BLAST of CU124320 vs. NCBI nr
Match: gi|747053327|ref|XP_011072822.1| (PREDICTED: dCTP pyrophosphatase 1-like [Sesamum indicum]) HSP 1 Score: 70.1 bits (170), Expect = 1.8e-09 Identity = 35/56 (62.50%), Postives = 38/56 (67.86%), Query Frame = 3
BLAST of CU124320 vs. NCBI nr
Match: gi|698510370|ref|XP_009800357.1| (PREDICTED: dCTP pyrophosphatase 1-like isoform X1 [Nicotiana sylvestris]) HSP 1 Score: 70.1 bits (170), Expect = 1.8e-09 Identity = 36/62 (58.06%), Postives = 40/62 (64.52%), Query Frame = 3
BLAST of CU124320 vs. NCBI nr
Match: gi|698510374|ref|XP_009800358.1| (PREDICTED: dCTP pyrophosphatase 1-like isoform X2 [Nicotiana sylvestris]) HSP 1 Score: 70.1 bits (170), Expect = 1.8e-09 Identity = 36/62 (58.06%), Postives = 40/62 (64.52%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|