CU124231 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGGCCAAGTTGCCGTTTGTATCCGACGATTGATGTTGTCCCACCCTGAGGTTGAGTGGATTTGGTGGATGGACAGTGATGCTTTATTTACTGATATGGTATTTGAGATTCCTTTGGAAAAATATGATAACTATAACTTGGTCGTTCATGGTTACCCTGATTTGATGTTCAACCAAAAGTCCTGGATTGCACTCAATACAGGAAGCTTTTTGTTTAGGAATTGTCAGTGGTCTTTGGATTTGCTGGATG
BLAST of CU124231 vs. Swiss-Prot
Match: XXT3_ARATH (Probable xyloglucan 6-xylosyltransferase 3 OS=Arabidopsis thaliana GN=XXT3 PE=2 SV=1) HSP 1 Score: 157.9 bits (398), Expect = 4.9e-38 Identity = 68/76 (89.47%), Postives = 73/76 (96.05%), Query Frame = 1
BLAST of CU124231 vs. Swiss-Prot
Match: XXT4_ARATH (Xyloglucan 6-xylosyltransferase 4 OS=Arabidopsis thaliana GN=XXT4 PE=1 SV=1) HSP 1 Score: 149.8 bits (377), Expect = 1.3e-35 Identity = 64/76 (84.21%), Postives = 70/76 (92.11%), Query Frame = 1
BLAST of CU124231 vs. Swiss-Prot
Match: XXT5_ARATH (Probable xyloglucan 6-xylosyltransferase 5 OS=Arabidopsis thaliana GN=XXT5 PE=1 SV=1) HSP 1 Score: 148.7 bits (374), Expect = 2.9e-35 Identity = 64/76 (84.21%), Postives = 70/76 (92.11%), Query Frame = 1
BLAST of CU124231 vs. Swiss-Prot
Match: GT2_ORYSI (Probable glycosyltransferase 2 OS=Oryza sativa subsp. indica GN=GT2 PE=3 SV=1) HSP 1 Score: 143.3 bits (360), Expect = 1.2e-33 Identity = 61/76 (80.26%), Postives = 67/76 (88.16%), Query Frame = 1
BLAST of CU124231 vs. Swiss-Prot
Match: GT2_ORYSJ (Probable glycosyltransferase 2 OS=Oryza sativa subsp. japonica GN=GT2 PE=2 SV=1) HSP 1 Score: 143.3 bits (360), Expect = 1.2e-33 Identity = 61/76 (80.26%), Postives = 67/76 (88.16%), Query Frame = 1
BLAST of CU124231 vs. TrEMBL
Match: A0A0A0LP65_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G010930 PE=4 SV=1) HSP 1 Score: 168.3 bits (425), Expect = 4.0e-39 Identity = 76/76 (100.00%), Postives = 76/76 (100.00%), Query Frame = 1
BLAST of CU124231 vs. TrEMBL
Match: A0A0A0LRQ8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G009930 PE=4 SV=1) HSP 1 Score: 168.3 bits (425), Expect = 4.0e-39 Identity = 76/76 (100.00%), Postives = 76/76 (100.00%), Query Frame = 1
BLAST of CU124231 vs. TrEMBL
Match: F6GT58_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_17s0000g06590 PE=4 SV=1) HSP 1 Score: 166.4 bits (420), Expect = 1.5e-38 Identity = 75/76 (98.68%), Postives = 75/76 (98.68%), Query Frame = 1
BLAST of CU124231 vs. TrEMBL
Match: A5B3I5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_027037 PE=4 SV=1) HSP 1 Score: 166.4 bits (420), Expect = 1.5e-38 Identity = 75/76 (98.68%), Postives = 75/76 (98.68%), Query Frame = 1
BLAST of CU124231 vs. TrEMBL
Match: W9QRS3_9ROSA (Putative glycosyltransferase 5 OS=Morus notabilis GN=L484_008579 PE=4 SV=1) HSP 1 Score: 162.5 bits (410), Expect = 2.2e-37 Identity = 73/76 (96.05%), Postives = 75/76 (98.68%), Query Frame = 1
BLAST of CU124231 vs. NCBI nr
Match: gi|449440812|ref|XP_004138178.1| (PREDICTED: putative glycosyltransferase 5 [Cucumis sativus]) HSP 1 Score: 170.2 bits (430), Expect = 1.5e-39 Identity = 76/76 (100.00%), Postives = 76/76 (100.00%), Query Frame = 1
BLAST of CU124231 vs. NCBI nr
Match: gi|449440814|ref|XP_004138179.1| (PREDICTED: putative glycosyltransferase 5 [Cucumis sativus]) HSP 1 Score: 170.2 bits (430), Expect = 1.5e-39 Identity = 76/76 (100.00%), Postives = 76/76 (100.00%), Query Frame = 1
BLAST of CU124231 vs. NCBI nr
Match: gi|225457345|ref|XP_002284667.1| (PREDICTED: putative glycosyltransferase 5 [Vitis vinifera]) HSP 1 Score: 168.3 bits (425), Expect = 5.7e-39 Identity = 75/76 (98.68%), Postives = 75/76 (98.68%), Query Frame = 1
BLAST of CU124231 vs. NCBI nr
Match: gi|297733940|emb|CBI15187.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 168.3 bits (425), Expect = 5.7e-39 Identity = 75/76 (98.68%), Postives = 75/76 (98.68%), Query Frame = 1
BLAST of CU124231 vs. NCBI nr
Match: gi|147855862|emb|CAN80739.1| (hypothetical protein VITISV_027037 [Vitis vinifera]) HSP 1 Score: 168.3 bits (425), Expect = 5.7e-39 Identity = 75/76 (98.68%), Postives = 75/76 (98.68%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|