CU124163 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAAGAGGTGAGTATGCAGTCAAATGCACATTTCTTGAAGAGCAAACCTCTCTCAGCTTCCTTTGCCTCCACATTACGTGCATTTCTACCTGATTAATGGCAGGAGGTAAAGAAGCAAAATCCAGCAAATGTAAGAGCTTTTTAGAAGAGAAATTGCTAACACCAATGGTCTTAGTTAAGCCTAATTCCACACACTTTTCCCCCGG
BLAST of CU124163 vs. Swiss-Prot
Match: MER_ERYCB (Methylecgonone reductase OS=Erythroxylum coca PE=1 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 7.6e-18 Identity = 39/66 (59.09%), Postives = 52/66 (78.79%), Query Frame = -1
BLAST of CU124163 vs. Swiss-Prot
Match: COR2_PAPSO (Non-functional NADPH-dependent codeinone reductase 2 OS=Papaver somniferum GN=COR2 PE=1 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 7.6e-18 Identity = 41/66 (62.12%), Postives = 53/66 (80.30%), Query Frame = -1
BLAST of CU124163 vs. Swiss-Prot
Match: AKRC9_ARATH (Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana GN=AKR4C9 PE=1 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 7.1e-16 Identity = 39/66 (59.09%), Postives = 46/66 (69.70%), Query Frame = -1
BLAST of CU124163 vs. Swiss-Prot
Match: GALUR_FRAAN (D-galacturonate reductase OS=Fragaria ananassa GN=GALUR PE=1 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 7.1e-16 Identity = 36/66 (54.55%), Postives = 49/66 (74.24%), Query Frame = -1
BLAST of CU124163 vs. Swiss-Prot
Match: NADO2_ORYSJ (Probable NAD(P)H-dependent oxidoreductase 2 OS=Oryza sativa subsp. japonica GN=Os10g0113100 PE=2 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 1.6e-15 Identity = 41/66 (62.12%), Postives = 45/66 (68.18%), Query Frame = -1
BLAST of CU124163 vs. TrEMBL
Match: A0A0A0LTV7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043150 PE=4 SV=1) HSP 1 Score: 136.0 bits (341), Expect = 1.8e-29 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -1
BLAST of CU124163 vs. TrEMBL
Match: R0F0E8_9BRAS (Uncharacterized protein OS=Capsella rubella GN=CARUB_v10028376mg PE=4 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 3.3e-20 Identity = 44/66 (66.67%), Postives = 58/66 (87.88%), Query Frame = -1
BLAST of CU124163 vs. TrEMBL
Match: A0A068UAN3_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00020347001 PE=4 SV=1) HSP 1 Score: 104.8 bits (260), Expect = 4.3e-20 Identity = 46/66 (69.70%), Postives = 57/66 (86.36%), Query Frame = -1
BLAST of CU124163 vs. TrEMBL
Match: A0A061G738_THECC (NAD(P)-linked oxidoreductase superfamily protein OS=Theobroma cacao GN=TCM_014909 PE=4 SV=1) HSP 1 Score: 104.4 bits (259), Expect = 5.7e-20 Identity = 45/66 (68.18%), Postives = 58/66 (87.88%), Query Frame = -1
BLAST of CU124163 vs. TrEMBL
Match: A0A0D2NZS0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_003G113200 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 7.4e-20 Identity = 44/66 (66.67%), Postives = 57/66 (86.36%), Query Frame = -1
BLAST of CU124163 vs. NCBI nr
Match: gi|778657514|ref|XP_011651026.1| (PREDICTED: aldo-keto reductase family 4 member C9-like [Cucumis sativus]) HSP 1 Score: 137.1 bits (344), Expect = 1.1e-29 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -1
BLAST of CU124163 vs. NCBI nr
Match: gi|659066965|ref|XP_008436964.1| (PREDICTED: aldo-keto reductase family 4 member C9-like [Cucumis melo]) HSP 1 Score: 132.1 bits (331), Expect = 3.6e-28 Identity = 61/66 (92.42%), Postives = 66/66 (100.00%), Query Frame = -1
BLAST of CU124163 vs. NCBI nr
Match: gi|565438058|ref|XP_006282124.1| (hypothetical protein CARUB_v10028376mg [Capsella rubella]) HSP 1 Score: 106.3 bits (264), Expect = 2.1e-20 Identity = 44/66 (66.67%), Postives = 58/66 (87.88%), Query Frame = -1
BLAST of CU124163 vs. NCBI nr
Match: gi|727540975|ref|XP_010444090.1| (PREDICTED: aldo-keto reductase family 4 member C9-like [Camelina sativa]) HSP 1 Score: 106.3 bits (264), Expect = 2.1e-20 Identity = 44/66 (66.67%), Postives = 58/66 (87.88%), Query Frame = -1
BLAST of CU124163 vs. NCBI nr
Match: gi|727426207|ref|XP_010458904.1| (PREDICTED: aldo-keto reductase family 4 member C9-like [Camelina sativa]) HSP 1 Score: 106.3 bits (264), Expect = 2.1e-20 Identity = 44/66 (66.67%), Postives = 58/66 (87.88%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|