CU123869 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAGACACAGTTTGTGCATTGTGAAAAATTAAAGGAATGTGATATAAGAGTAGATTCTGTAGATACAGATGAAACTGATGATGAAGAAAATTATTATCACGAGGGGAGGGAAATTCCTTTTAACATCAAGGATTGGGAAATTAATGGAAACTCCAAAGGTGCCAATGATCCTAAACAACATATATACCTCGATTCAAATTCAAGATACTTGGAGAATCACTCTGGTGCTGAAAACAACCAACAAAAGCCAAAAAAAAA
BLAST of CU123869 vs. TrEMBL
Match: A0A0A0LS12_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G062980 PE=4 SV=1) HSP 1 Score: 154.8 bits (390), Expect = 4.6e-35 Identity = 72/85 (84.71%), Postives = 74/85 (87.06%), Query Frame = 1
BLAST of CU123869 vs. NCBI nr
Match: gi|778658410|ref|XP_011652674.1| (PREDICTED: uncharacterized protein LOC105435044 [Cucumis sativus]) HSP 1 Score: 151.4 bits (381), Expect = 7.3e-34 Identity = 72/85 (84.71%), Postives = 74/85 (87.06%), Query Frame = 1
BLAST of CU123869 vs. NCBI nr
Match: gi|700209427|gb|KGN64523.1| (hypothetical protein Csa_1G062980 [Cucumis sativus]) HSP 1 Score: 151.4 bits (381), Expect = 7.3e-34 Identity = 72/85 (84.71%), Postives = 74/85 (87.06%), Query Frame = 1
BLAST of CU123869 vs. NCBI nr
Match: gi|659067742|ref|XP_008441076.1| (PREDICTED: uncharacterized protein LOC103485300 [Cucumis melo]) HSP 1 Score: 129.4 bits (324), Expect = 3.0e-27 Identity = 64/85 (75.29%), Postives = 66/85 (77.65%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|