CU123820 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CATTTCCAGCACAACGTTCACAAGGCACCGGACCACCCTTAAGACCAAGAAAGAGCGAAAGAGAAATGGCAACCAAGACACTGAGAGTAGCAAGAAAAGTTTGGGTGTCAATTGGGGCATCGAAACTGTCGAAGAGCAAAAGGGGGTGAATAAGAGGGTCAATTGGGTGAATCGCAGCCGCGGAAAGTTGGAGACCAGTGGAGGAAGTGGTTGCAGCTGAGACAGACAGCAAAAAAGAGAGGAACTTTCAGGTTTTAGCAA
BLAST of CU123820 vs. TrEMBL
Match: A0A0A0LQ07_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025260 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 4.8e-16 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = -3
BLAST of CU123820 vs. TrEMBL
Match: D7T1M2_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_06s0009g00970 PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 4.2e-12 Identity = 36/44 (81.82%), Postives = 39/44 (88.64%), Query Frame = -3
BLAST of CU123820 vs. TrEMBL
Match: M5WF60_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa023756mg PE=4 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 5.5e-12 Identity = 36/44 (81.82%), Postives = 39/44 (88.64%), Query Frame = -3
BLAST of CU123820 vs. TrEMBL
Match: A0A103XHJ8_CYNCS (Uncharacterized protein OS=Cynara cardunculus var. scolymus GN=Ccrd_007136 PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.6e-11 Identity = 35/41 (85.37%), Postives = 38/41 (92.68%), Query Frame = -3
BLAST of CU123820 vs. TrEMBL
Match: A0A0B0PGQ8_GOSAR (Chaperone DnaJ OS=Gossypium arboreum GN=F383_00759 PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.6e-11 Identity = 34/41 (82.93%), Postives = 38/41 (92.68%), Query Frame = -3
BLAST of CU123820 vs. NCBI nr
Match: gi|449439164|ref|XP_004137357.1| (PREDICTED: uncharacterized protein LOC101204110 isoform X1 [Cucumis sativus]) HSP 1 Score: 91.7 bits (226), Expect = 6.9e-16 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = -3
BLAST of CU123820 vs. NCBI nr
Match: gi|778656544|ref|XP_011649264.1| (PREDICTED: uncharacterized protein LOC101204110 isoform X2 [Cucumis sativus]) HSP 1 Score: 91.7 bits (226), Expect = 6.9e-16 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = -3
BLAST of CU123820 vs. NCBI nr
Match: gi|659107067|ref|XP_008453508.1| (PREDICTED: uncharacterized protein LOC103494197 isoform X2 [Cucumis melo]) HSP 1 Score: 90.1 bits (222), Expect = 2.0e-15 Identity = 43/44 (97.73%), Postives = 43/44 (97.73%), Query Frame = -3
BLAST of CU123820 vs. NCBI nr
Match: gi|659107063|ref|XP_008453507.1| (PREDICTED: uncharacterized protein LOC103494197 isoform X1 [Cucumis melo]) HSP 1 Score: 90.1 bits (222), Expect = 2.0e-15 Identity = 43/44 (97.73%), Postives = 43/44 (97.73%), Query Frame = -3
BLAST of CU123820 vs. NCBI nr
Match: gi|225436093|ref|XP_002277657.1| (PREDICTED: protein disulfide-isomerase LQY1 [Vitis vinifera]) HSP 1 Score: 78.6 bits (192), Expect = 6.1e-12 Identity = 36/44 (81.82%), Postives = 39/44 (88.64%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|