CU123736 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU123736
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr7 : 4859129 .. 4859207 (+)
Sequence length	89

The following sequences are available for this feature:

GACATGTGGGGTTTGGTGGAGTTAGTGTCGGCGGCAGCGTAGTGAAGGAGTGCAGAGGAAATGGGATGGGGGAGGGGAAGAAAGATCAC


Library category	ESTs
fruit (8DPP) library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa7G073440	Csa7G073440	gene
Csa7G073430	Csa7G073430	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
FKNP3UI02KNLZB	FKNP3UI02KNLZB	EST