CU123593 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTGAATTACAAGGGTCTCCTTTGTTCCAGTTGCTCAGATTCCCATTAGGATCGAACAAACTACTTTTGATGAGGAGCAAAGCGTCCACTTCAGAGGGGTGGGTACCCATTTCTGCTGCAACAACAACTAGTAAGGACGACGAGAAGCAGAGGAGCAGAAGGGCTACATAAGCCCACTGCTGTGATCGACGACACATTTCAGAAGTGGAAGCACTCAAAATACACAAAGAATTGAAAGCTTTGGGGAGG
BLAST of CU123593 vs. TrEMBL
Match: A0A0A0LV88_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G028040 PE=4 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 2.9e-18 Identity = 47/65 (72.31%), Postives = 47/65 (72.31%), Query Frame = -2
BLAST of CU123593 vs. TrEMBL
Match: A0A0B2QAK9_GLYSO (Putative LRR receptor-like serine/threonine-protein kinase OS=Glycine soja GN=glysoja_033753 PE=3 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 7.3e-06 Identity = 26/34 (76.47%), Postives = 26/34 (76.47%), Query Frame = -2
BLAST of CU123593 vs. TrEMBL
Match: I1MZN5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_18G050700 PE=3 SV=2) HSP 1 Score: 57.8 bits (138), Expect = 7.3e-06 Identity = 26/34 (76.47%), Postives = 26/34 (76.47%), Query Frame = -2
BLAST of CU123593 vs. TrEMBL
Match: K4CT54_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 9.6e-06 Identity = 25/34 (73.53%), Postives = 27/34 (79.41%), Query Frame = -2
BLAST of CU123593 vs. NCBI nr
Match: gi|700208830|gb|KGN63926.1| (hypothetical protein Csa_1G028040 [Cucumis sativus]) HSP 1 Score: 99.0 bits (245), Expect = 4.1e-18 Identity = 47/65 (72.31%), Postives = 47/65 (72.31%), Query Frame = -2
BLAST of CU123593 vs. NCBI nr
Match: gi|449439195|ref|XP_004137372.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g06840 [Cucumis sativus]) HSP 1 Score: 99.0 bits (245), Expect = 4.1e-18 Identity = 47/65 (72.31%), Postives = 47/65 (72.31%), Query Frame = -2
BLAST of CU123593 vs. NCBI nr
Match: gi|659114903|ref|XP_008457284.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g06840 [Cucumis melo]) HSP 1 Score: 97.1 bits (240), Expect = 1.6e-17 Identity = 46/65 (70.77%), Postives = 46/65 (70.77%), Query Frame = -2
BLAST of CU123593 vs. NCBI nr
Match: gi|698548318|ref|XP_009768306.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g06840 [Nicotiana sylvestris]) HSP 1 Score: 58.2 bits (139), Expect = 8.1e-06 Identity = 25/34 (73.53%), Postives = 26/34 (76.47%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|