CU123241 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCTCTCAGCTACTAGAATTTTTGGTAGATGCAGAGAAAAGTCTATGTGAGAAAGCTTTGGGAATTTTGGATGGAATTTGTGATTACAAACAAGGGGAGAGAGAAGCTTTACAATAATGCACTAACTATTCCACTCTTAGTCAAGAAGATCCTTAGAGTTTCAGAGTTAGCCACTGAATATTCTCTGTCAATATTGTTGAAGCTCTGCAAGAGTGGTGAGGAGGGCGAGAATGAGGTGA
BLAST of CU123241 vs. Swiss-Prot
Match: PUB21_ARATH (U-box domain-containing protein 21 OS=Arabidopsis thaliana GN=PUB21 PE=2 SV=1) HSP 1 Score: 54.3 bits (129), Expect = 7.0e-07 Identity = 27/44 (61.36%), Postives = 33/44 (75.00%), Query Frame = 1
HSP 2 Score: 42.0 bits (97), Expect = 3.6e-03 Identity = 17/31 (54.84%), Postives = 21/31 (67.74%), Query Frame = 3
BLAST of CU123241 vs. TrEMBL
Match: A0A0A0LAV4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G308190 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 1.2e-16 Identity = 47/49 (95.92%), Postives = 49/49 (100.00%), Query Frame = 1
BLAST of CU123241 vs. TrEMBL
Match: A0A0A0LAV4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G308190 PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.0e-08 Identity = 31/34 (91.18%), Postives = 32/34 (94.12%), Query Frame = 3
HSP 2 Score: 66.6 bits (161), Expect = 1.5e-08 Identity = 33/48 (68.75%), Postives = 37/48 (77.08%), Query Frame = 1
BLAST of CU123241 vs. TrEMBL
Match: M5WAJ2_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa005659mg PE=4 SV=1) HSP 1 Score: 48.1 bits (113), Expect = 5.5e-03 Identity = 19/35 (54.29%), Postives = 28/35 (80.00%), Query Frame = 3
HSP 2 Score: 65.1 bits (157), Expect = 4.4e-08 Identity = 32/52 (61.54%), Postives = 43/52 (82.69%), Query Frame = 1
BLAST of CU123241 vs. TrEMBL
Match: Q93VZ1_PETCR (Immediate-early fungal elicitor protein CMPG1 OS=Petroselinum crispum GN=CMPG1 PE=2 SV=1) HSP 1 Score: 47.4 bits (111), Expect = 9.4e-03 Identity = 20/34 (58.82%), Postives = 27/34 (79.41%), Query Frame = 3
HSP 2 Score: 65.1 bits (157), Expect = 4.4e-08 Identity = 31/44 (70.45%), Postives = 39/44 (88.64%), Query Frame = 1
BLAST of CU123241 vs. TrEMBL
Match: W9RRX1_9ROSA (U-box domain-containing protein 20 OS=Morus notabilis GN=L484_019305 PE=4 SV=1) HSP 1 Score: 47.8 bits (112), Expect = 7.2e-03 Identity = 20/33 (60.61%), Postives = 27/33 (81.82%), Query Frame = 3
HSP 2 Score: 65.1 bits (157), Expect = 4.4e-08 Identity = 32/51 (62.75%), Postives = 43/51 (84.31%), Query Frame = 1
BLAST of CU123241 vs. NCBI nr
Match: gi|449456206|ref|XP_004145841.1| (PREDICTED: U-box domain-containing protein 21 [Cucumis sativus]) HSP 1 Score: 92.0 bits (227), Expect = 4.9e-16 Identity = 47/49 (95.92%), Postives = 49/49 (100.00%), Query Frame = 1
BLAST of CU123241 vs. NCBI nr
Match: gi|659114404|ref|XP_008457035.1| (PREDICTED: U-box domain-containing protein 21-like [Cucumis melo]) HSP 1 Score: 90.1 bits (222), Expect = 1.8e-15 Identity = 46/49 (93.88%), Postives = 49/49 (100.00%), Query Frame = 1
BLAST of CU123241 vs. NCBI nr
Match: gi|1009166093|ref|XP_015901401.1| (PREDICTED: U-box domain-containing protein 21-like [Ziziphus jujuba]) HSP 1 Score: 68.2 bits (165), Expect = 7.5e-09 Identity = 36/49 (73.47%), Postives = 43/49 (87.76%), Query Frame = 1
BLAST of CU123241 vs. NCBI nr
Match: gi|645270334|ref|XP_008240411.1| (PREDICTED: U-box domain-containing protein 21-like [Prunus mume]) HSP 1 Score: 65.5 bits (158), Expect = 4.9e-08 Identity = 33/48 (68.75%), Postives = 37/48 (77.08%), Query Frame = 1
BLAST of CU123241 vs. NCBI nr
Match: gi|595846434|ref|XP_007209132.1| (hypothetical protein PRUPE_ppa005659mg [Prunus persica]) HSP 1 Score: 65.5 bits (158), Expect = 4.9e-08 Identity = 33/48 (68.75%), Postives = 37/48 (77.08%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|