CU123025 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGCTTCGACATCTCGGCGAAGGCGGCGAAGAATGTAGTGTCGGGAACGCCGCCGGAGTTCAGGATTTTACCGCTGGTTTAGATTTCCGAAGAGAGAGCATTCCATTTTCGCGTGGACGAGTTGGAGGTATTTTGGAGCGGGTGAATTTAGCGAATATGGAGTTGGGGTTTTGAGAAATGAAGATTTTAGGGTTTACTGGTTTGAGCTTCTTGAATTTTTCGAACATTTGGTGGTTTAGCTGCTTATCATGGGTAAGGGAATCGTT
BLAST of CU123025 vs. TrEMBL
Match: A0A0A0KNM5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G520250 PE=4 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 2.6e-17 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = -1
BLAST of CU123025 vs. TrEMBL
Match: A0A0A0KNM5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G520250 PE=4 SV=1) HSP 1 Score: 47.4 bits (111), Expect = 1.1e-02 Identity = 21/21 (100.00%), Postives = 21/21 (100.00%), Query Frame = -2
HSP 2 Score: 47.4 bits (111), Expect = 1.1e-02 Identity = 22/22 (100.00%), Postives = 22/22 (100.00%), Query Frame = -3
HSP 3 Score: 87.4 bits (215), Expect = 9.3e-15 Identity = 41/45 (91.11%), Postives = 42/45 (93.33%), Query Frame = -1
BLAST of CU123025 vs. TrEMBL
Match: E5GC28_CUCME (UNE1-like protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 47.4 bits (111), Expect = 1.1e-02 Identity = 21/21 (100.00%), Postives = 21/21 (100.00%), Query Frame = -2
HSP 2 Score: 47.4 bits (111), Expect = 1.1e-02 Identity = 22/22 (100.00%), Postives = 22/22 (100.00%), Query Frame = -3
BLAST of CU123025 vs. NCBI nr
Match: gi|449433629|ref|XP_004134600.1| (PREDICTED: uncharacterized protein LOC101220727 [Cucumis sativus]) HSP 1 Score: 94.4 bits (233), Expect = 1.1e-16 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = -1
BLAST of CU123025 vs. NCBI nr
Match: gi|659078425|ref|XP_008439717.1| (PREDICTED: uncharacterized protein LOC103484433 [Cucumis melo]) HSP 1 Score: 85.9 bits (211), Expect = 3.9e-14 Identity = 41/45 (91.11%), Postives = 42/45 (93.33%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|