CU122052 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AACTGAACATTATCCGTTGACTTATTATAATAAATTACAACAATCCACAACCATATAATATATAACATACATGCATAACAAGTTAATTTGATGTAAAATAAAATAAGCAACACACTTCTTCAAATTATCAATCTTAAAAATAAATTTGATCCATTTGCTGCCCACCAAGAAACGGCATTTTTAATTAGTAGCTTCGTCGTCTCCATATAATCATTCTCCTCAGACCAATTGTAAGAAAGGCAATTGTTTGGAGTATGTTATAATTGACACGATCCACAACTCGAAAGTAGAATATTCTCCTTGCTTCATTTGTGAAAATGGTAAAGAACAGTATGTTGATGCCAAATGGAAAACCAATTGCCATACTAATATAGAAGCCAGCCATTTCCGAGTCATTTTCAGCTTTGCCATCTT
BLAST of CU122052 vs. TrEMBL
Match: A0A0A0LWU0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G051880 PE=4 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 5.7e-27 Identity = 63/68 (92.65%), Postives = 64/68 (94.12%), Query Frame = -3
BLAST of CU122052 vs. TrEMBL
Match: A0A0A0LTZ3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G051860 PE=4 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 2.2e-26 Identity = 63/72 (87.50%), Postives = 66/72 (91.67%), Query Frame = -3
BLAST of CU122052 vs. TrEMBL
Match: A0A0A0LBE5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G812120 PE=4 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 3.6e-13 Identity = 42/69 (60.87%), Postives = 51/69 (73.91%), Query Frame = -3
BLAST of CU122052 vs. TrEMBL
Match: A0A0A0LRA2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G051870 PE=4 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 1.1e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = -3
BLAST of CU122052 vs. NCBI nr
Match: gi|778658237|ref|XP_011652343.1| (PREDICTED: receptor-like protein 12 [Cucumis sativus]) HSP 1 Score: 131.0 bits (328), Expect = 1.6e-27 Identity = 66/72 (91.67%), Postives = 67/72 (93.06%), Query Frame = -3
BLAST of CU122052 vs. NCBI nr
Match: gi|700209355|gb|KGN64451.1| (hypothetical protein Csa_1G051880 [Cucumis sativus]) HSP 1 Score: 125.6 bits (314), Expect = 6.9e-26 Identity = 63/68 (92.65%), Postives = 64/68 (94.12%), Query Frame = -3
BLAST of CU122052 vs. NCBI nr
Match: gi|659067587|ref|XP_008440232.1| (PREDICTED: leucine-rich repeat receptor protein kinase EXS-like, partial [Cucumis melo]) HSP 1 Score: 124.4 bits (311), Expect = 1.5e-25 Identity = 61/68 (89.71%), Postives = 63/68 (92.65%), Query Frame = -3
BLAST of CU122052 vs. NCBI nr
Match: gi|778658234|ref|XP_011652339.1| (PREDICTED: LOW QUALITY PROTEIN: LRR receptor-like serine/threonine-protein kinase FLS2 [Cucumis sativus]) HSP 1 Score: 123.6 bits (309), Expect = 2.6e-25 Identity = 63/72 (87.50%), Postives = 66/72 (91.67%), Query Frame = -3
BLAST of CU122052 vs. NCBI nr
Match: gi|700209353|gb|KGN64449.1| (hypothetical protein Csa_1G051860 [Cucumis sativus]) HSP 1 Score: 123.6 bits (309), Expect = 2.6e-25 Identity = 63/72 (87.50%), Postives = 66/72 (91.67%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|