CU121976 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACTAAAAATAGTTTCAAACACTTTTATTTTTTTAACTCAAACGTGGCATAGTTGTGTAATTGAAGATTTTACCAGTAAGTTTTATTATACTAATAGATGTCTTATTCATTAACACTAACTACAAACTCTTTGTAAATGATAGATAAGCAAAGTTACGATCGTGCTCCAAGATCGGCTTAGGAGATATTATCCAGAAGGTGAGAGAGAGGGGAAGAAAAACAAGCGACTTGGTAATATGATATTTAATCTGATTGATCAATCTCTGTAAAACATCTCACGTGGAACTGTTATACATAGTGCAGTATGGACTTCTTTAGGTTGTTTTCATCTCAAAGATCCATGTGTACCTCAAAATGGCAACGTTCAACTCCTAGTTGCAAACAATGTCAGAGTAAAAGCCTATTGTCCTCCTCTGACAATCTTGGACGCTTAACAGTTCCACATCAAAGACTTCAAACTGTTTTGAGCTGAAAAATGTGGAAGGCCCCACAGGAGGTCCAAGTTCTGGTGGGATTATCATTCTCCT
BLAST of CU121976 vs. Swiss-Prot
Match: FK202_ARATH (Peptidyl-prolyl cis-trans isomerase FKBP20-2, chloroplastic OS=Arabidopsis thaliana GN=FKBP20-2 PE=1 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 8.0e-19 Identity = 44/52 (84.62%), Postives = 48/52 (92.31%), Query Frame = -1
BLAST of CU121976 vs. TrEMBL
Match: A0A0A0L5Q7_CUCSA (Peptidyl-prolyl cis-trans isomerase OS=Cucumis sativus GN=Csa_3G118090 PE=4 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 7.7e-21 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = -1
BLAST of CU121976 vs. TrEMBL
Match: A0A067HCN2_CITSI (Peptidyl-prolyl cis-trans isomerase OS=Citrus sinensis GN=CISIN_1g025317mg PE=4 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 6.6e-20 Identity = 48/51 (94.12%), Postives = 51/51 (100.00%), Query Frame = -1
BLAST of CU121976 vs. TrEMBL
Match: A0A022QZE0_ERYGU (Peptidyl-prolyl cis-trans isomerase OS=Erythranthe guttata GN=MIMGU_mgv1a012536mg PE=4 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 6.6e-20 Identity = 48/51 (94.12%), Postives = 50/51 (98.04%), Query Frame = -1
BLAST of CU121976 vs. TrEMBL
Match: A0A067H3P5_CITSI (Peptidyl-prolyl cis-trans isomerase OS=Citrus sinensis GN=CISIN_1g025317mg PE=4 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 6.6e-20 Identity = 48/51 (94.12%), Postives = 51/51 (100.00%), Query Frame = -1
BLAST of CU121976 vs. TrEMBL
Match: V4U8Y4_9ROSI (Peptidyl-prolyl cis-trans isomerase OS=Citrus clementina GN=CICLE_v10021814mg PE=4 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 6.6e-20 Identity = 48/51 (94.12%), Postives = 51/51 (100.00%), Query Frame = -1
BLAST of CU121976 vs. NCBI nr
Match: gi|449431986|ref|XP_004133781.1| (PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP20-2, chloroplastic [Cucumis sativus]) HSP 1 Score: 110.9 bits (276), Expect = 2.2e-21 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = -1
BLAST of CU121976 vs. NCBI nr
Match: gi|641866861|gb|KDO85545.1| (hypothetical protein CISIN_1g025317mg [Citrus sinensis]) HSP 1 Score: 107.8 bits (268), Expect = 1.9e-20 Identity = 48/51 (94.12%), Postives = 51/51 (100.00%), Query Frame = -1
BLAST of CU121976 vs. NCBI nr
Match: gi|848886573|ref|XP_012843529.1| (PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP20-2, chloroplastic isoform X1 [Erythranthe guttata]) HSP 1 Score: 107.8 bits (268), Expect = 1.9e-20 Identity = 48/51 (94.12%), Postives = 50/51 (98.04%), Query Frame = -1
BLAST of CU121976 vs. NCBI nr
Match: gi|848886576|ref|XP_012843530.1| (PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP20-2, chloroplastic isoform X2 [Erythranthe guttata]) HSP 1 Score: 107.8 bits (268), Expect = 1.9e-20 Identity = 48/51 (94.12%), Postives = 50/51 (98.04%), Query Frame = -1
BLAST of CU121976 vs. NCBI nr
Match: gi|567905826|ref|XP_006445401.1| (hypothetical protein CICLE_v10021814mg [Citrus clementina]) HSP 1 Score: 107.8 bits (268), Expect = 1.9e-20 Identity = 48/51 (94.12%), Postives = 51/51 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|