CU121819 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTGCAATAGGAGGATTTCTAACACATTGTGGATGGAACTCAACTATTGAGAGTATATCTGCTGGTATTCCAATGGTGTGTTGGCCTTTTCTTTGCTGATCAACAGACAAGTTGTTGTTATTGTTGCAATGTGTGGGGGAGTTGGAATGGAGATTGATAACAATGTGAAAAGAAATGAAGTTGAAGAGTTGGTGAGAGAGTTAATGGATGGAGAAAAAGGTAAAG
BLAST of CU121819 vs. Swiss-Prot
Match: U85A3_ARATH (UDP-glycosyltransferase 85A3 OS=Arabidopsis thaliana GN=UGT85A3 PE=2 SV=2) HSP 1 Score: 65.5 bits (158), Expect = 2.9e-10 Identity = 24/29 (82.76%), Postives = 26/29 (89.66%), Query Frame = 3
HSP 2 Score: 44.7 bits (104), Expect = 5.2e-04 Identity = 21/28 (75.00%), Postives = 22/28 (78.57%), Query Frame = 2
BLAST of CU121819 vs. Swiss-Prot
Match: U85A4_ARATH (UDP-glycosyltransferase 85A4 OS=Arabidopsis thaliana GN=UGT85A4 PE=2 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 4.9e-10 Identity = 24/29 (82.76%), Postives = 26/29 (89.66%), Query Frame = 3
HSP 2 Score: 44.7 bits (104), Expect = 5.2e-04 Identity = 20/29 (68.97%), Postives = 21/29 (72.41%), Query Frame = 2
BLAST of CU121819 vs. Swiss-Prot
Match: U85A2_ARATH (UDP-glycosyltransferase 85A2 OS=Arabidopsis thaliana GN=UGT85A2 PE=2 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 8.3e-10 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 3
HSP 2 Score: 41.6 bits (96), Expect = 4.4e-03 Identity = 20/28 (71.43%), Postives = 22/28 (78.57%), Query Frame = 2
BLAST of CU121819 vs. Swiss-Prot
Match: U85A1_ARATH (UDP-glycosyltransferase 85A1 OS=Arabidopsis thaliana GN=UGT85A1 PE=2 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.1e-09 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 3
HSP 2 Score: 44.7 bits (104), Expect = 5.2e-04 Identity = 21/28 (75.00%), Postives = 22/28 (78.57%), Query Frame = 2
BLAST of CU121819 vs. Swiss-Prot
Match: UGT6_CATRO (7-deoxyloganetin glucosyltransferase OS=Catharanthus roseus GN=UGT85A23 PE=1 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 1.9e-09 Identity = 25/29 (86.21%), Postives = 26/29 (89.66%), Query Frame = 3
HSP 2 Score: 46.6 bits (109), Expect = 1.4e-04 Identity = 21/29 (72.41%), Postives = 25/29 (86.21%), Query Frame = 2
HSP 3 Score: 36.2 bits (82), Expect = 1.9e-01 Identity = 12/17 (70.59%), Postives = 13/17 (76.47%), Query Frame = 1
BLAST of CU121819 vs. TrEMBL
Match: A0A0A0K416_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G063980 PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.2e-09 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU121819 vs. TrEMBL
Match: A0A0A0K416_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G063980 PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 7.8e-07 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 2
HSP 2 Score: 47.4 bits (111), Expect = 9.0e-03 Identity = 17/17 (100.00%), Postives = 17/17 (100.00%), Query Frame = 1
HSP 3 Score: 67.0 bits (162), Expect = 1.1e-08 Identity = 25/29 (86.21%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU121819 vs. TrEMBL
Match: W6JNS9_HUMLU (Glycosyltransferase OS=Humulus lupulus GN=HIUGT279 PE=2 SV=1) HSP 1 Score: 47.4 bits (111), Expect = 9.0e-03 Identity = 22/28 (78.57%), Postives = 26/28 (92.86%), Query Frame = 2
HSP 2 Score: 67.0 bits (162), Expect = 1.1e-08 Identity = 25/29 (86.21%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU121819 vs. TrEMBL
Match: W6JMG5_HUMLU (Glycosyltransferase OS=Humulus lupulus GN=HIUGT119 PE=2 SV=1) HSP 1 Score: 47.4 bits (111), Expect = 9.0e-03 Identity = 22/28 (78.57%), Postives = 26/28 (92.86%), Query Frame = 2
HSP 2 Score: 65.9 bits (159), Expect = 2.4e-08 Identity = 24/29 (82.76%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU121819 vs. TrEMBL
Match: A0A161ZYN8_DAUCA (UDP-glycosyltransferase OS=Daucus carota subsp. sativus GN=DCAR_016707 PE=4 SV=1) HSP 1 Score: 37.4 bits (85), Expect = 9.3e+00 Identity = 17/28 (60.71%), Postives = 23/28 (82.14%), Query Frame = 2
HSP 2 Score: 65.9 bits (159), Expect = 2.4e-08 Identity = 24/29 (82.76%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU121819 vs. NCBI nr
Match: gi|778724432|ref|XP_011658803.1| (PREDICTED: 7-deoxyloganetin glucosyltransferase-like [Cucumis sativus]) HSP 1 Score: 70.1 bits (170), Expect = 1.9e-09 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU121819 vs. NCBI nr
Match: gi|586941119|dbj|BAO51841.1| (UDP-glycosyltransferase 85A35 [Humulus lupulus]) HSP 1 Score: 67.8 bits (164), Expect = 9.2e-09 Identity = 25/29 (86.21%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU121819 vs. NCBI nr
Match: gi|586941113|dbj|BAO51838.1| (UDP-glycosyltransferase 85A36 [Humulus lupulus]) HSP 1 Score: 67.8 bits (164), Expect = 9.2e-09 Identity = 25/29 (86.21%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU121819 vs. NCBI nr
Match: gi|923925677|ref|XP_013731826.1| (PREDICTED: UDP-glycosyltransferase 85A1-like [Brassica napus]) HSP 1 Score: 67.0 bits (162), Expect = 1.6e-08 Identity = 27/48 (56.25%), Postives = 32/48 (66.67%), Query Frame = 3
BLAST of CU121819 vs. NCBI nr
Match: gi|747081244|ref|XP_011087901.1| (PREDICTED: 7-deoxyloganetin glucosyltransferase-like [Sesamum indicum]) HSP 1 Score: 67.0 bits (162), Expect = 1.6e-08 Identity = 25/29 (86.21%), Postives = 29/29 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|