CU121804 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU121804
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr7 : 6739414 .. 6739496 (-)
Sequence length	106

The following sequences are available for this feature:

CGGCCGGGGGGAACAAATTCAATTCCACAGCCTGTCTTTGCCCTCTCGTCGGTGATCAAACAACCAACTCCTCCCTCTCTCTCTCTCTCTCGCCGAACGTAATTAG


Library category	ESTs
fruit (8DPP) library	1
gynoecious flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa7G186190	Csa7G186190	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
FKNP3UI02OSK99	FKNP3UI02OSK99	EST
G0091190	G0091190	EST