CU121795 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTCTCTCTCTCTCTCTGCTCTAAAAGTCGTCGTGTACTTTCATCTAGTACCTCTTGTTCTTCATTATCCTCTCGTATCAATAATGCATTTACCTCTTCGTCGTTTTGTGCGTATGCGGCTGTCGTTTCGTTCGAATCTTCACCGACACATGGGAAGTACATTTTCCCCATTGTACCGTCGTCGGACCAATCTCTCCACGACGGCGACGCCAAATC
BLAST of CU121795 vs. TrEMBL
Match: A0A0A0L6C4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G124790 PE=4 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 4.4e-31 Identity = 67/67 (100.00%), Postives = 67/67 (100.00%), Query Frame = -1
BLAST of CU121795 vs. NCBI nr
Match: gi|449432203|ref|XP_004133889.1| (PREDICTED: uncharacterized protein LOC101208043 [Cucumis sativus]) HSP 1 Score: 136.0 bits (341), Expect = 2.6e-29 Identity = 67/67 (100.00%), Postives = 67/67 (100.00%), Query Frame = -1
BLAST of CU121795 vs. NCBI nr
Match: gi|659075370|ref|XP_008438109.1| (PREDICTED: uncharacterized protein LOC103483313 isoform X2 [Cucumis melo]) HSP 1 Score: 114.4 bits (285), Expect = 8.2e-23 Identity = 57/67 (85.07%), Postives = 61/67 (91.04%), Query Frame = -1
BLAST of CU121795 vs. NCBI nr
Match: gi|659075368|ref|XP_008438108.1| (PREDICTED: uncharacterized protein LOC103483313 isoform X1 [Cucumis melo]) HSP 1 Score: 109.4 bits (272), Expect = 2.6e-21 Identity = 57/69 (82.61%), Postives = 61/69 (88.41%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|