CU121329 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCTACATAACTTTCGTCAACACTGAGTACAATCATCGTCGTCTTCTCAATTCCAGAGGCCCCAGTTCGTTGGATGGCTTGCCAGATTTTAAGTTCCGAACCATTCCCGACGGCCTTCCCTACTCGGACGCCAACTGTACTCAAGATGTTCCTTCACTTTGCCAGTCCGTCTCCAGGAATTGCTTAGCTCCTTTTTTTGAACTTATTTCTGAACTTAACTCAATAGCA
BLAST of CU121329 vs. Swiss-Prot
Match: UGT2_GARJA (7-deoxyloganetin glucosyltransferase OS=Gardenia jasminoides GN=UGT85A24 PE=1 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 2.1e-24 Identity = 49/73 (67.12%), Postives = 60/73 (82.19%), Query Frame = 1
BLAST of CU121329 vs. Swiss-Prot
Match: U85A2_ARATH (UDP-glycosyltransferase 85A2 OS=Arabidopsis thaliana GN=UGT85A2 PE=2 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 5.2e-23 Identity = 45/74 (60.81%), Postives = 60/74 (81.08%), Query Frame = 1
BLAST of CU121329 vs. Swiss-Prot
Match: U85A5_ARATH (UDP-glycosyltransferase 85A5 OS=Arabidopsis thaliana GN=UGT85A5 PE=2 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 1.5e-22 Identity = 45/74 (60.81%), Postives = 57/74 (77.03%), Query Frame = 1
BLAST of CU121329 vs. Swiss-Prot
Match: UGT6_CATRO (7-deoxyloganetin glucosyltransferase OS=Catharanthus roseus GN=UGT85A23 PE=1 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 7.4e-22 Identity = 46/73 (63.01%), Postives = 57/73 (78.08%), Query Frame = 1
BLAST of CU121329 vs. Swiss-Prot
Match: U85A7_ARATH (UDP-glycosyltransferase 85A7 OS=Arabidopsis thaliana GN=UGT85A7 PE=2 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 3.7e-21 Identity = 42/73 (57.53%), Postives = 55/73 (75.34%), Query Frame = 1
BLAST of CU121329 vs. TrEMBL
Match: A0A0A0K416_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G063980 PE=4 SV=1) HSP 1 Score: 155.2 bits (391), Expect = 3.1e-35 Identity = 74/76 (97.37%), Postives = 74/76 (97.37%), Query Frame = 1
BLAST of CU121329 vs. TrEMBL
Match: A0A0A0K2K3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G063920 PE=4 SV=1) HSP 1 Score: 142.1 bits (357), Expect = 2.7e-31 Identity = 64/76 (84.21%), Postives = 72/76 (94.74%), Query Frame = 1
BLAST of CU121329 vs. TrEMBL
Match: A0A0A0K602_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G063420 PE=4 SV=1) HSP 1 Score: 141.0 bits (354), Expect = 6.1e-31 Identity = 63/76 (82.89%), Postives = 72/76 (94.74%), Query Frame = 1
BLAST of CU121329 vs. TrEMBL
Match: A0A0A0K7D2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G062920 PE=4 SV=1) HSP 1 Score: 141.0 bits (354), Expect = 6.1e-31 Identity = 63/76 (82.89%), Postives = 72/76 (94.74%), Query Frame = 1
BLAST of CU121329 vs. TrEMBL
Match: A0A0A0K227_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G063990 PE=4 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 3.0e-30 Identity = 64/76 (84.21%), Postives = 70/76 (92.11%), Query Frame = 1
BLAST of CU121329 vs. NCBI nr
Match: gi|778724432|ref|XP_011658803.1| (PREDICTED: 7-deoxyloganetin glucosyltransferase-like [Cucumis sativus]) HSP 1 Score: 156.4 bits (394), Expect = 2.0e-35 Identity = 74/76 (97.37%), Postives = 74/76 (97.37%), Query Frame = 1
BLAST of CU121329 vs. NCBI nr
Match: gi|659110378|ref|XP_008455195.1| (PREDICTED: UDP-glycosyltransferase 85A5-like [Cucumis melo]) HSP 1 Score: 153.3 bits (386), Expect = 1.7e-34 Identity = 71/76 (93.42%), Postives = 74/76 (97.37%), Query Frame = 1
BLAST of CU121329 vs. NCBI nr
Match: gi|778724426|ref|XP_011658801.1| (PREDICTED: 7-deoxyloganetin glucosyltransferase-like [Cucumis sativus]) HSP 1 Score: 143.3 bits (360), Expect = 1.8e-31 Identity = 64/76 (84.21%), Postives = 72/76 (94.74%), Query Frame = 1
BLAST of CU121329 vs. NCBI nr
Match: gi|700188495|gb|KGN43728.1| (hypothetical protein Csa_7G063920 [Cucumis sativus]) HSP 1 Score: 143.3 bits (360), Expect = 1.8e-31 Identity = 64/76 (84.21%), Postives = 72/76 (94.74%), Query Frame = 1
BLAST of CU121329 vs. NCBI nr
Match: gi|778724429|ref|XP_011658802.1| (PREDICTED: 7-deoxyloganetin glucosyltransferase-like [Cucumis sativus]) HSP 1 Score: 142.1 bits (357), Expect = 3.9e-31 Identity = 63/76 (82.89%), Postives = 72/76 (94.74%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|