CU120593 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTCTCCCAGCTTCTTCATCCATAGGCTGATCAAGCTTCTGATCCAGAACCCACATACTTCCCCTCGTTTCACAATCATCATCGGTTTCCACTCTTGAAGTCATCTTAGTTTCAATTTGAAAAGAACCCCAATCAAGTAAGGACAGCTAAAAAATTCTCAGTAAAATCCAACAACAGAAGCCTGGTTTTTACTTCAAAATCTATATTCAACACCAGCTATGAACTGCACGCCGACTAAATTGAATACAAGAAAAAACATGGGTCATGGCCGATTCTGCAAATTTGGCAAGTTGACATGCCAAA
BLAST of CU120593 vs. TrEMBL
Match: A0A0A0LRC4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G057060 PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 5.4e-11 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -2
BLAST of CU120593 vs. TrEMBL
Match: A0A0D2SV27_GOSRA (Potassium transporter OS=Gossypium raimondii GN=B456_008G049100 PE=3 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 3.6e-07 Identity = 28/35 (80.00%), Postives = 31/35 (88.57%), Query Frame = -2
BLAST of CU120593 vs. TrEMBL
Match: A0A151S671_CAJCA (Potassium transporter OS=Cajanus cajan GN=KK1_027960 PE=3 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 6.2e-07 Identity = 28/34 (82.35%), Postives = 30/34 (88.24%), Query Frame = -2
BLAST of CU120593 vs. TrEMBL
Match: A0A0B0MLN2_GOSAR (Potassium transporter 11 OS=Gossypium arboreum GN=F383_22242 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 8.1e-07 Identity = 27/37 (72.97%), Postives = 32/37 (86.49%), Query Frame = -2
BLAST of CU120593 vs. TrEMBL
Match: A0A0B0MRX8_GOSAR (Potassium transporter 11 OS=Gossypium arboreum GN=F383_22242 PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 1.1e-06 Identity = 27/35 (77.14%), Postives = 31/35 (88.57%), Query Frame = -2
BLAST of CU120593 vs. NCBI nr
Match: gi|700209374|gb|KGN64470.1| (hypothetical protein Csa_1G057060 [Cucumis sativus]) HSP 1 Score: 74.3 bits (181), Expect = 1.3e-10 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -2
BLAST of CU120593 vs. NCBI nr
Match: gi|778658295|ref|XP_011652452.1| (PREDICTED: potassium transporter 10-like [Cucumis sativus]) HSP 1 Score: 74.3 bits (181), Expect = 1.3e-10 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -2
BLAST of CU120593 vs. NCBI nr
Match: gi|659067648|ref|XP_008440560.1| (PREDICTED: potassium transporter 11-like [Cucumis melo]) HSP 1 Score: 70.9 bits (172), Expect = 1.5e-09 Identity = 32/34 (94.12%), Postives = 33/34 (97.06%), Query Frame = -2
BLAST of CU120593 vs. NCBI nr
Match: gi|823204741|ref|XP_012436573.1| (PREDICTED: potassium transporter 11 [Gossypium raimondii]) HSP 1 Score: 62.0 bits (149), Expect = 6.8e-07 Identity = 28/35 (80.00%), Postives = 31/35 (88.57%), Query Frame = -2
BLAST of CU120593 vs. NCBI nr
Match: gi|1012339017|gb|KYP50257.1| (Potassium transporter 11 [Cajanus cajan]) HSP 1 Score: 60.8 bits (146), Expect = 1.5e-06 Identity = 28/34 (82.35%), Postives = 30/34 (88.24%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|