CU120581 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGGAGGGTTCCGGCGCCACATTCGAATCGCAAATTCTCGTCGACCCTTCCCGAATTGTCAATAGAGAAGGAGAAGGAGATTTGATCTGATAGGATCAAGCAACTGTAACAAGTCCGAGAGGACCGCACCTAGTCCGGCCATATCTATCTCAAGATGAAAGTAAAAAAGTTGAAGACTGCTACAACTTCTAATACTAATGTTGATTTGAAGTCCATCATTCATCAGCATGCCCTGTTCATCGACAAGTTGGTGGAGCTC
BLAST of CU120581 vs. TrEMBL
Match: A0A0A0LNJ3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G001420 PE=4 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 1.2e-09 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 3
BLAST of CU120581 vs. NCBI nr
Match: gi|449440532|ref|XP_004138038.1| (PREDICTED: ribosomal RNA-processing protein 14-C [Cucumis sativus]) HSP 1 Score: 69.3 bits (168), Expect = 3.8e-09 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 3
BLAST of CU120581 vs. NCBI nr
Match: gi|659128866|ref|XP_008464410.1| (PREDICTED: ribosomal RNA-processing protein 14-C [Cucumis melo]) HSP 1 Score: 65.5 bits (158), Expect = 5.4e-08 Identity = 33/35 (94.29%), Postives = 34/35 (97.14%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|