CU119716 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTGGCATTCTGTAATGCATATGGATGTGGACTCACGGATTGGTCTTTGGCATCCACTTACGGAAAGCTTGCCATTTTCACAATTGGCGCATGGGCTGGGCCCTCGCGTGGGGGAATTATTGCTGGTCTATCAGCTTGTGGGGTCATGATGAACATTGTCTCGACACGCCTCAGACCTTACGCAGGATTTCAAGACTGGCTATCTAACTTTAGCTTCACCTCGCTCCATGTTTGTCAGCCAAGTGGTAGGCACAACAATGGGTTGCATTATTTCCCCTTGTGTCTTTTGGCTCTTCTACAAGGCATTTGACGATCTTGGTCTTCCAACCGGTGAACCG
BLAST of CU119716 vs. Swiss-Prot
Match: YSL7_ARATH (Probable metal-nicotianamine transporter YSL7 OS=Arabidopsis thaliana GN=YSL7 PE=2 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 1.2e-23 Identity = 50/55 (90.91%), Postives = 51/55 (92.73%), Query Frame = 2
HSP 2 Score: 98.2 bits (243), Expect = 6.0e-20 Identity = 43/53 (81.13%), Postives = 45/53 (84.91%), Query Frame = 3
BLAST of CU119716 vs. Swiss-Prot
Match: YSL8_ARATH (Probable metal-nicotianamine transporter YSL8 OS=Arabidopsis thaliana GN=YSL8 PE=1 SV=2) HSP 1 Score: 109.4 bits (272), Expect = 2.6e-23 Identity = 48/56 (85.71%), Postives = 51/56 (91.07%), Query Frame = 3
HSP 2 Score: 105.1 bits (261), Expect = 4.9e-22 Identity = 48/55 (87.27%), Postives = 49/55 (89.09%), Query Frame = 2
BLAST of CU119716 vs. Swiss-Prot
Match: YSL5_ARATH (Probable metal-nicotianamine transporter YSL5 OS=Arabidopsis thaliana GN=YSL5 PE=1 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 3.4e-23 Identity = 48/56 (85.71%), Postives = 51/56 (91.07%), Query Frame = 3
HSP 2 Score: 104.8 bits (260), Expect = 6.4e-22 Identity = 48/55 (87.27%), Postives = 49/55 (89.09%), Query Frame = 2
BLAST of CU119716 vs. Swiss-Prot
Match: YSL10_ORYSJ (Probable metal-nicotianamine transporter YSL10 OS=Oryza sativa subsp. japonica GN=YSL10 PE=2 SV=2) HSP 1 Score: 102.8 bits (255), Expect = 2.4e-21 Identity = 47/55 (85.45%), Postives = 49/55 (89.09%), Query Frame = 2
HSP 2 Score: 101.7 bits (252), Expect = 5.4e-21 Identity = 45/56 (80.36%), Postives = 49/56 (87.50%), Query Frame = 3
BLAST of CU119716 vs. Swiss-Prot
Match: YSL12_ORYSJ (Probable metal-nicotianamine transporter YSL12 OS=Oryza sativa subsp. japonica GN=YSL12 PE=2 SV=2) HSP 1 Score: 99.8 bits (247), Expect = 2.1e-20 Identity = 45/55 (81.82%), Postives = 47/55 (85.45%), Query Frame = 2
HSP 2 Score: 99.4 bits (246), Expect = 2.7e-20 Identity = 44/52 (84.62%), Postives = 47/52 (90.38%), Query Frame = 3
BLAST of CU119716 vs. TrEMBL
Match: A0A0A0LQZ8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043160 PE=4 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 1.3e-24 Identity = 60/79 (75.95%), Postives = 63/79 (79.75%), Query Frame = 3
BLAST of CU119716 vs. TrEMBL
Match: A0A0A0LQZ8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043160 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 8.2e-24 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 2
HSP 2 Score: 111.7 bits (278), Expect = 5.9e-22 Identity = 51/55 (92.73%), Postives = 54/55 (98.18%), Query Frame = 2
BLAST of CU119716 vs. TrEMBL
Match: M4GQK9_SOYBN (YSL1 OS=Glycine max PE=2 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 3.6e-19 Identity = 45/53 (84.91%), Postives = 51/53 (96.23%), Query Frame = 3
HSP 2 Score: 111.7 bits (278), Expect = 5.9e-22 Identity = 51/55 (92.73%), Postives = 54/55 (98.18%), Query Frame = 2
BLAST of CU119716 vs. TrEMBL
Match: I1LM19_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_11G203400 PE=4 SV=2) HSP 1 Score: 102.4 bits (254), Expect = 3.6e-19 Identity = 45/53 (84.91%), Postives = 51/53 (96.23%), Query Frame = 3
HSP 2 Score: 111.3 bits (277), Expect = 7.6e-22 Identity = 50/55 (90.91%), Postives = 54/55 (98.18%), Query Frame = 2
BLAST of CU119716 vs. TrEMBL
Match: V7C6J6_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_004G138900g PE=4 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 1.3e-18 Identity = 45/56 (80.36%), Postives = 50/56 (89.29%), Query Frame = 3
HSP 2 Score: 111.3 bits (277), Expect = 7.6e-22 Identity = 51/55 (92.73%), Postives = 53/55 (96.36%), Query Frame = 2
BLAST of CU119716 vs. NCBI nr
Match: gi|778657517|ref|XP_011651033.1| (PREDICTED: probable metal-nicotianamine transporter YSL5 [Cucumis sativus]) HSP 1 Score: 123.6 bits (309), Expect = 2.1e-25 Identity = 60/79 (75.95%), Postives = 63/79 (79.75%), Query Frame = 3
BLAST of CU119716 vs. NCBI nr
Match: gi|659066967|ref|XP_008436975.1| (PREDICTED: LOW QUALITY PROTEIN: probable metal-nicotianamine transporter YSL5 [Cucumis melo]) HSP 1 Score: 123.6 bits (309), Expect = 2.1e-25 Identity = 60/79 (75.95%), Postives = 63/79 (79.75%), Query Frame = 3
BLAST of CU119716 vs. NCBI nr
Match: gi|702503323|ref|XP_010039025.1| (PREDICTED: probable metal-nicotianamine transporter YSL7 [Eucalyptus grandis]) HSP 1 Score: 113.6 bits (283), Expect = 2.2e-22 Identity = 55/79 (69.62%), Postives = 59/79 (74.68%), Query Frame = 3
BLAST of CU119716 vs. NCBI nr
Match: gi|729375609|ref|XP_010549025.1| (PREDICTED: probable metal-nicotianamine transporter YSL8 isoform X2 [Tarenaya hassleriana]) HSP 1 Score: 112.5 bits (280), Expect = 4.9e-22 Identity = 49/56 (87.50%), Postives = 53/56 (94.64%), Query Frame = 3
BLAST of CU119716 vs. NCBI nr
Match: gi|729375606|ref|XP_010549024.1| (PREDICTED: probable metal-nicotianamine transporter YSL8 isoform X1 [Tarenaya hassleriana]) HSP 1 Score: 112.5 bits (280), Expect = 4.9e-22 Identity = 49/56 (87.50%), Postives = 53/56 (94.64%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|