CU119518 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTTCCTAGTTTTTGATGGGTTCTTCTGTGCATTGAGATGGCTCTCTCTGTCTATTTCTCTGCTTCTAAACACTCTTACACACATAGTTCCATAGTTCCATATCTTTGCAGGGTTCTTTTGTAATCTCACAATTATAATTCTCCCTTATCCATAGACGTTATTTCCCTTATTGCTGCCGCACAAAACCTCACACCCAATTATCCATCATTTGCAGTGAATGAAGACACACTTTTCAAAGCCATGAACAAGTACAGAAGTTCCAAAGAACTTACACCCATGCATAGGAACTCAAAAGCAGACTGCCTCGTCAAGCAAATTGCTTGGGACTTAGACGATCAGTCGCCCCT
BLAST of CU119518 vs. TrEMBL
Match: A6YTC6_CUCME (GPI-anchored protein-like protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.8e-13 Identity = 39/44 (88.64%), Postives = 40/44 (90.91%), Query Frame = 1
BLAST of CU119518 vs. TrEMBL
Match: A6YTC6_CUCME (GPI-anchored protein-like protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 39.3 bits (90), Expect = 3.8e+00 Identity = 19/44 (43.18%), Postives = 29/44 (65.91%), Query Frame = 1
HSP 2 Score: 77.4 bits (189), Expect = 1.3e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 1
BLAST of CU119518 vs. NCBI nr
Match: gi|150036257|gb|ABR67420.1| (GPI-anchored protein-like protein [Cucumis melo subsp. melo]) HSP 1 Score: 83.6 bits (205), Expect = 2.5e-13 Identity = 39/44 (88.64%), Postives = 40/44 (90.91%), Query Frame = 1
BLAST of CU119518 vs. NCBI nr
Match: gi|659070382|ref|XP_008454803.1| (PREDICTED: uncharacterized GPI-anchored protein At5g19250-like [Cucumis melo]) HSP 1 Score: 83.6 bits (205), Expect = 2.5e-13 Identity = 39/44 (88.64%), Postives = 40/44 (90.91%), Query Frame = 1
BLAST of CU119518 vs. NCBI nr
Match: gi|700205775|gb|KGN60894.1| (hypothetical protein Csa_2G021650 [Cucumis sativus]) HSP 1 Score: 77.4 bits (189), Expect = 1.8e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|