CU119110 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAACTCGAGAATTTTTGGTTGACGATGATTCCGTAATCTTAAGTATCTTGGATTGCATGCTCTTTCAATCCTTGTGCCAAAACACTCGTGGGCAGTTTTGGAGAATAAAGAGGTTGTAATCAAATCTCTAAGTG
BLAST of CU119110 vs. Swiss-Prot
Match: AP3D_ARATH (AP-3 complex subunit delta OS=Arabidopsis thaliana GN=DELTA-ADR PE=1 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 2.7e-08 Identity = 26/33 (78.79%), Postives = 29/33 (87.88%), Query Frame = 2
BLAST of CU119110 vs. TrEMBL
Match: A0A0A0LQE4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042420 PE=4 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 2.9e-09 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = 2
BLAST of CU119110 vs. TrEMBL
Match: A0A059A5D1_EUCGR (AP-3 complex subunit delta OS=Eucalyptus grandis GN=EUGRSUZ_K02232 PE=3 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 1.9e-08 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = 2
BLAST of CU119110 vs. TrEMBL
Match: D7L8G2_ARALL (AP-3 complex subunit delta OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_341963 PE=3 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.1e-07 Identity = 28/34 (82.35%), Postives = 31/34 (91.18%), Query Frame = 2
BLAST of CU119110 vs. TrEMBL
Match: B9SFZ1_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0726280 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 3.6e-07 Identity = 28/34 (82.35%), Postives = 32/34 (94.12%), Query Frame = 2
BLAST of CU119110 vs. TrEMBL
Match: A0A0L9TI09_PHAAN (AP-3 complex subunit delta OS=Phaseolus angularis GN=LR48_Vigan847s001000 PE=3 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 6.1e-07 Identity = 27/33 (81.82%), Postives = 30/33 (90.91%), Query Frame = 2
BLAST of CU119110 vs. NCBI nr
Match: gi|659066742|ref|XP_008459026.1| (PREDICTED: AP-3 complex subunit delta [Cucumis melo]) HSP 1 Score: 68.9 bits (167), Expect = 2.5e-09 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = 2
BLAST of CU119110 vs. NCBI nr
Match: gi|449439415|ref|XP_004137481.1| (PREDICTED: AP-3 complex subunit delta [Cucumis sativus]) HSP 1 Score: 68.9 bits (167), Expect = 2.5e-09 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = 2
BLAST of CU119110 vs. NCBI nr
Match: gi|702495110|ref|XP_010036902.1| (PREDICTED: AP-3 complex subunit delta [Eucalyptus grandis]) HSP 1 Score: 66.2 bits (160), Expect = 1.6e-08 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = 2
BLAST of CU119110 vs. NCBI nr
Match: gi|297834730|ref|XP_002885247.1| (hypothetical protein ARALYDRAFT_341963 [Arabidopsis lyrata subsp. lyrata]) HSP 1 Score: 62.8 bits (151), Expect = 1.8e-07 Identity = 28/34 (82.35%), Postives = 31/34 (91.18%), Query Frame = 2
BLAST of CU119110 vs. NCBI nr
Match: gi|1000954200|ref|XP_015578262.1| (PREDICTED: AP-3 complex subunit delta [Ricinus communis]) HSP 1 Score: 62.0 bits (149), Expect = 3.0e-07 Identity = 28/34 (82.35%), Postives = 32/34 (94.12%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|