CU118882 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATTGAAGCTTTCTTCTCAGACTCATAATCGACTTCAAAGTCACAGCTGAATTCCCATTTGGGCTCTCCATGAGAAGCGACGGAAGCTGTGGGAGTCATTGCTTCAATTCTAATGAAAAACAGCCAGATTTCCCCCCACAAATAAACCGGTAACGGCAGCGGGTAGTAGGAGGCGTGGCGAGGATGGTCGGCGGCGAGGCTGAGGCGTGGCAGTGGAAGAAATGGGGAAGAAGTTGAGACCGTGACTCGTTGAAGACGAAGACC
BLAST of CU118882 vs. TrEMBL
Match: A0A0A0L7A2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G238730 PE=4 SV=1) HSP 1 Score: 143.7 bits (361), Expect = 1.1e-31 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = -1
BLAST of CU118882 vs. TrEMBL
Match: A0A0A0L7A2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G238730 PE=4 SV=1) HSP 1 Score: 30.8 bits (68), Expect = 1.0e+03 Identity = 13/13 (100.00%), Postives = 13/13 (100.00%), Query Frame = -3
BLAST of CU118882 vs. NCBI nr
Match: gi|700202525|gb|KGN57658.1| (hypothetical protein Csa_3G238730 [Cucumis sativus]) HSP 1 Score: 144.4 bits (363), Expect = 9.2e-32 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = -1
BLAST of CU118882 vs. NCBI nr
Match: gi|449456983|ref|XP_004146228.1| (PREDICTED: uncharacterized protein LOC101217139 [Cucumis sativus]) HSP 1 Score: 73.6 bits (179), Expect = 2.0e-10 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = -1
BLAST of CU118882 vs. NCBI nr
Match: gi|659133652|ref|XP_008466840.1| (PREDICTED: uncharacterized protein LOC103504146 [Cucumis melo]) HSP 1 Score: 67.0 bits (162), Expect = 1.9e-08 Identity = 31/33 (93.94%), Postives = 31/33 (93.94%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|