CU118262 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCAATTTAGAGACTTACCATTCCCTCCTCTCCACTCTCAACATAACCCCTCCCACCCCCTTCGCCGAGCAGGACTTTTTGAACATGTTCTTCAAAGACAAGTACAAGCCAATTCCACCTGTCTACAATCTGGTGATGGCAATGCTATGGCGCCACCCAGAAAACATAGAGCTCCACAAAGTCAAAGTGGTTCACTATTGCGCTGCCGGTTCAAAGCCATGGAGGTACACAGGCAAGGAGGAAGAACATGGACCGGGAAGACGTTAAG
BLAST of CU118262 vs. Swiss-Prot
Match: GOLS1_ARATH (Galactinol synthase 1 OS=Arabidopsis thaliana GN=GOLS1 PE=1 SV=1) HSP 1 Score: 148.7 bits (374), Expect = 3.0e-35 Identity = 68/79 (86.08%), Postives = 69/79 (87.34%), Query Frame = 3
BLAST of CU118262 vs. Swiss-Prot
Match: GOLS2_ARATH (Galactinol synthase 2 OS=Arabidopsis thaliana GN=GOLS2 PE=1 SV=1) HSP 1 Score: 147.1 bits (370), Expect = 8.9e-35 Identity = 65/80 (81.25%), Postives = 71/80 (88.75%), Query Frame = 3
BLAST of CU118262 vs. Swiss-Prot
Match: GOLS2_SOLLC (Galactinol synthase 2 OS=Solanum lycopersicum GN=GOLS2 PE=2 SV=1) HSP 1 Score: 145.6 bits (366), Expect = 2.6e-34 Identity = 64/80 (80.00%), Postives = 69/80 (86.25%), Query Frame = 3
BLAST of CU118262 vs. Swiss-Prot
Match: GOLS2_AJURE (Galactinol synthase 2 (Fragment) OS=Ajuga reptans GN=GOLS2 PE=1 SV=1) HSP 1 Score: 144.4 bits (363), Expect = 5.8e-34 Identity = 64/80 (80.00%), Postives = 68/80 (85.00%), Query Frame = 3
BLAST of CU118262 vs. Swiss-Prot
Match: GOLS3_ARATH (Galactinol synthase 3 OS=Arabidopsis thaliana GN=GOLS3 PE=1 SV=1) HSP 1 Score: 144.4 bits (363), Expect = 5.8e-34 Identity = 62/79 (78.48%), Postives = 71/79 (89.87%), Query Frame = 3
BLAST of CU118262 vs. TrEMBL
Match: A0A0A0LT16_CUCSA (Hexosyltransferase OS=Cucumis sativus GN=Csa_1G181330 PE=3 SV=1) HSP 1 Score: 175.6 bits (444), Expect = 2.6e-41 Identity = 80/80 (100.00%), Postives = 80/80 (100.00%), Query Frame = 3
BLAST of CU118262 vs. TrEMBL
Match: G7KTP3_MEDTR (Hexosyltransferase OS=Medicago truncatula GN=MTR_7g109920 PE=3 SV=1) HSP 1 Score: 156.0 bits (393), Expect = 2.1e-35 Identity = 68/80 (85.00%), Postives = 75/80 (93.75%), Query Frame = 3
BLAST of CU118262 vs. TrEMBL
Match: U3PYH4_9FABA (Hexosyltransferase OS=Vicia hirsuta GN=GolS1 PE=3 SV=1) HSP 1 Score: 154.5 bits (389), Expect = 6.2e-35 Identity = 67/80 (83.75%), Postives = 74/80 (92.50%), Query Frame = 3
BLAST of CU118262 vs. TrEMBL
Match: A0A068V3M2_COFCA (Hexosyltransferase OS=Coffea canephora GN=GSCOC_T00042860001 PE=3 SV=1) HSP 1 Score: 152.9 bits (385), Expect = 1.8e-34 Identity = 67/80 (83.75%), Postives = 74/80 (92.50%), Query Frame = 3
BLAST of CU118262 vs. TrEMBL
Match: W9QW76_9ROSA (Hexosyltransferase OS=Morus notabilis GN=L484_018780 PE=3 SV=1) HSP 1 Score: 152.5 bits (384), Expect = 2.4e-34 Identity = 67/80 (83.75%), Postives = 74/80 (92.50%), Query Frame = 3
BLAST of CU118262 vs. NCBI nr
Match: gi|449443518|ref|XP_004139524.1| (PREDICTED: galactinol synthase 2-like [Cucumis sativus]) HSP 1 Score: 176.0 bits (445), Expect = 2.8e-41 Identity = 80/80 (100.00%), Postives = 80/80 (100.00%), Query Frame = 3
BLAST of CU118262 vs. NCBI nr
Match: gi|659127227|ref|XP_008463593.1| (PREDICTED: galactinol synthase 2-like [Cucumis melo]) HSP 1 Score: 175.6 bits (444), Expect = 3.7e-41 Identity = 79/80 (98.75%), Postives = 80/80 (100.00%), Query Frame = 3
BLAST of CU118262 vs. NCBI nr
Match: gi|357511433|ref|XP_003626005.1| (galactinol synthase [Medicago truncatula]) HSP 1 Score: 156.4 bits (394), Expect = 2.3e-35 Identity = 68/80 (85.00%), Postives = 75/80 (93.75%), Query Frame = 3
BLAST of CU118262 vs. NCBI nr
Match: gi|545698810|gb|AGW51290.1| (putative galactinol synthase [Vicia hirsuta]) HSP 1 Score: 154.8 bits (390), Expect = 6.8e-35 Identity = 67/80 (83.75%), Postives = 74/80 (92.50%), Query Frame = 3
BLAST of CU118262 vs. NCBI nr
Match: gi|729353167|ref|XP_010544149.1| (PREDICTED: galactinol synthase 2-like [Tarenaya hassleriana]) HSP 1 Score: 153.3 bits (386), Expect = 2.0e-34 Identity = 68/80 (85.00%), Postives = 73/80 (91.25%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|