CU118235 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTGCTTTGGACGACAATTCTGTTTGCACTTTGAAGCATTTCGCCTAGGAACAGCACCTGTTTACATGGCATTCCTCCGGTTCATGGGTGACGACAGCGAGGCAAAACAGTTCTCATACAGTCTTGAAAGTTGGTGGAAATGGAAGAAAACTCATCTGGCAAGGTATTCCAAGAAGTATTCGCGACAGCCATCGGAAGGTTCGAGACAGTCATGATGGACTAATTATTCAGAGGAAATTGGCATTATTTT
BLAST of CU118235 vs. Swiss-Prot
Match: SINA2_ARATH (E3 ubiquitin-protein ligase SINAT2 OS=Arabidopsis thaliana GN=SINAT2 PE=1 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 8.6e-16 Identity = 37/42 (88.10%), Postives = 39/42 (92.86%), Query Frame = 2
HSP 2 Score: 72.4 bits (176), Expect = 2.6e-12 Identity = 34/42 (80.95%), Postives = 35/42 (83.33%), Query Frame = 3
BLAST of CU118235 vs. Swiss-Prot
Match: SINA1_ARATH (Putative E3 ubiquitin-protein ligase SINAT1 OS=Arabidopsis thaliana GN=SINAT1 PE=3 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 8.6e-16 Identity = 37/42 (88.10%), Postives = 39/42 (92.86%), Query Frame = 2
HSP 2 Score: 70.1 bits (170), Expect = 1.3e-11 Identity = 33/42 (78.57%), Postives = 34/42 (80.95%), Query Frame = 3
BLAST of CU118235 vs. Swiss-Prot
Match: SINA3_ARATH (E3 ubiquitin-protein ligase SINAT3 OS=Arabidopsis thaliana GN=SINAT3 PE=2 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 6.2e-14 Identity = 35/42 (83.33%), Postives = 37/42 (88.10%), Query Frame = 3
HSP 2 Score: 76.3 bits (186), Expect = 1.8e-13 Identity = 32/42 (76.19%), Postives = 37/42 (88.10%), Query Frame = 2
BLAST of CU118235 vs. Swiss-Prot
Match: SINA5_ARATH (E3 ubiquitin-protein ligase SINAT5 OS=Arabidopsis thaliana GN=SINAT5 PE=1 SV=2) HSP 1 Score: 74.7 bits (182), Expect = 5.2e-13 Identity = 31/42 (73.81%), Postives = 36/42 (85.71%), Query Frame = 2
HSP 2 Score: 74.7 bits (182), Expect = 5.2e-13 Identity = 33/42 (78.57%), Postives = 36/42 (85.71%), Query Frame = 3
BLAST of CU118235 vs. Swiss-Prot
Match: SINA4_ARATH (E3 ubiquitin-protein ligase SINAT4 OS=Arabidopsis thaliana GN=SINAT4 PE=2 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 5.2e-13 Identity = 34/42 (80.95%), Postives = 37/42 (88.10%), Query Frame = 3
HSP 2 Score: 74.3 bits (181), Expect = 6.8e-13 Identity = 31/42 (73.81%), Postives = 35/42 (83.33%), Query Frame = 2
BLAST of CU118235 vs. TrEMBL
Match: A0A0A0KWV9_CUCSA (E3 ubiquitin-protein ligase OS=Cucumis sativus GN=Csa_4G285710 PE=3 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 3.5e-16 Identity = 42/42 (100.00%), Postives = 42/42 (100.00%), Query Frame = 2
BLAST of CU118235 vs. TrEMBL
Match: A0A0A0KWV9_CUCSA (E3 ubiquitin-protein ligase OS=Cucumis sativus GN=Csa_4G285710 PE=3 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 1.1e-14 Identity = 41/42 (97.62%), Postives = 42/42 (100.00%), Query Frame = 3
HSP 2 Score: 89.7 bits (221), Expect = 1.7e-15 Identity = 43/62 (69.35%), Postives = 52/62 (83.87%), Query Frame = 2
BLAST of CU118235 vs. TrEMBL
Match: A0A078FJP9_BRANA (E3 ubiquitin-protein ligase OS=Brassica napus GN=BnaC02g24630D PE=3 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 3.4e-03 Identity = 21/27 (77.78%), Postives = 23/27 (85.19%), Query Frame = 3
HSP 2 Score: 86.7 bits (213), Expect = 1.5e-14 Identity = 38/42 (90.48%), Postives = 42/42 (100.00%), Query Frame = 2
BLAST of CU118235 vs. TrEMBL
Match: Q9XGC3_VITVI (E3 ubiquitin-protein ligase OS=Vitis vinifera GN=VIT_08s0007g06740 PE=2 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 5.3e-12 Identity = 36/42 (85.71%), Postives = 39/42 (92.86%), Query Frame = 3
HSP 2 Score: 86.7 bits (213), Expect = 1.5e-14 Identity = 38/42 (90.48%), Postives = 40/42 (95.24%), Query Frame = 2
BLAST of CU118235 vs. TrEMBL
Match: M5WJ19_PRUPE (E3 ubiquitin-protein ligase OS=Prunus persica GN=PRUPE_ppa009039mg PE=3 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.4e-11 Identity = 36/42 (85.71%), Postives = 38/42 (90.48%), Query Frame = 3
HSP 2 Score: 86.3 bits (212), Expect = 1.9e-14 Identity = 38/42 (90.48%), Postives = 42/42 (100.00%), Query Frame = 2
BLAST of CU118235 vs. NCBI nr
Match: gi|700198937|gb|KGN54095.1| (hypothetical protein Csa_4G285710 [Cucumis sativus]) HSP 1 Score: 92.0 bits (227), Expect = 5.0e-16 Identity = 42/42 (100.00%), Postives = 42/42 (100.00%), Query Frame = 2
BLAST of CU118235 vs. NCBI nr
Match: gi|659097725|ref|XP_008449780.1| (PREDICTED: E3 ubiquitin-protein ligase SINAT2 [Cucumis melo]) HSP 1 Score: 90.9 bits (224), Expect = 1.1e-15 Identity = 41/42 (97.62%), Postives = 42/42 (100.00%), Query Frame = 2
BLAST of CU118235 vs. NCBI nr
Match: gi|674918626|emb|CDY14650.1| (BnaC02g24630D [Brassica napus]) HSP 1 Score: 87.4 bits (215), Expect = 1.2e-14 Identity = 43/62 (69.35%), Postives = 52/62 (83.87%), Query Frame = 2
BLAST of CU118235 vs. NCBI nr
Match: gi|526117513|ref|NP_001268043.1| (SINA2p [Vitis vinifera]) HSP 1 Score: 86.7 bits (213), Expect = 2.1e-14 Identity = 38/42 (90.48%), Postives = 42/42 (100.00%), Query Frame = 2
BLAST of CU118235 vs. NCBI nr
Match: gi|645215298|ref|XP_008226952.1| (PREDICTED: E3 ubiquitin-protein ligase SINAT2-like [Prunus mume]) HSP 1 Score: 86.7 bits (213), Expect = 2.1e-14 Identity = 38/42 (90.48%), Postives = 40/42 (95.24%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|