CU118224 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTCCACACCAAACAAATTGCTCCCAAACCCATGTAACATTCTCTGTGGAGGCTCCACACTGATACTCTGAACATGCTGTCCCCTCGAATCTCTCTTCCACAGAGTTCGTTTCTTTGGTCCTTAGTAGCGGTCGAACGTCAATCAGTGAGAGTTTCCCATCACTTGAAGCTGAAACCAACCATGGAAACTCAAATGCTAGAGAATAAACTGGTCCTGAATGAGGAATCCAAGATCCAACCAGTTGAGCACTTGTA
BLAST of CU118224 vs. Swiss-Prot
Match: FBW3_ARATH (F-box/WD-40 repeat-containing protein At5g21040 OS=Arabidopsis thaliana GN=At5g21040 PE=2 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 4.1e-13 Identity = 33/46 (71.74%), Postives = 37/46 (80.43%), Query Frame = -2
HSP 2 Score: 45.4 bits (106), Expect = 3.5e-04 Identity = 20/31 (64.52%), Postives = 22/31 (70.97%), Query Frame = -3
BLAST of CU118224 vs. TrEMBL
Match: A0A0A0L0C6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G269200 PE=4 SV=1) HSP 1 Score: 98.6 bits (244), Expect = 3.8e-18 Identity = 47/48 (97.92%), Postives = 48/48 (100.00%), Query Frame = -2
BLAST of CU118224 vs. TrEMBL
Match: A0A0A0L0C6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G269200 PE=4 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 1.7e-13 Identity = 38/38 (100.00%), Postives = 38/38 (100.00%), Query Frame = -3
HSP 2 Score: 83.6 bits (205), Expect = 1.3e-13 Identity = 42/89 (47.19%), Postives = 55/89 (61.80%), Query Frame = -2
BLAST of CU118224 vs. TrEMBL
Match: A0A059AA99_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_J00620 PE=4 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 3.7e-13 Identity = 36/49 (73.47%), Postives = 45/49 (91.84%), Query Frame = -2
BLAST of CU118224 vs. TrEMBL
Match: A0A059AA99_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_J00620 PE=4 SV=1) HSP 1 Score: 38.9 bits (89), Expect = 3.6e+00 Identity = 20/38 (52.63%), Postives = 23/38 (60.53%), Query Frame = -3
HSP 2 Score: 80.1 bits (196), Expect = 1.4e-12 Identity = 37/51 (72.55%), Postives = 45/51 (88.24%), Query Frame = -2
BLAST of CU118224 vs. TrEMBL
Match: M5WAC3_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa003536mg PE=4 SV=1) HSP 1 Score: 38.9 bits (89), Expect = 3.6e+00 Identity = 20/37 (54.05%), Postives = 23/37 (62.16%), Query Frame = -3
HSP 2 Score: 80.1 bits (196), Expect = 1.4e-12 Identity = 37/51 (72.55%), Postives = 42/51 (82.35%), Query Frame = -2
BLAST of CU118224 vs. NCBI nr
Match: gi|778692827|ref|XP_011653530.1| (PREDICTED: F-box/WD-40 repeat-containing protein At5g21040 [Cucumis sativus]) HSP 1 Score: 99.4 bits (246), Expect = 3.2e-18 Identity = 47/48 (97.92%), Postives = 48/48 (100.00%), Query Frame = -2
BLAST of CU118224 vs. NCBI nr
Match: gi|659097885|ref|XP_008449867.1| (PREDICTED: F-box/WD-40 repeat-containing protein At5g21040 [Cucumis melo]) HSP 1 Score: 99.4 bits (246), Expect = 3.2e-18 Identity = 47/48 (97.92%), Postives = 48/48 (100.00%), Query Frame = -2
BLAST of CU118224 vs. NCBI nr
Match: gi|848876011|ref|XP_012838473.1| (PREDICTED: F-box/WD-40 repeat-containing protein At5g21040 [Erythranthe guttata]) HSP 1 Score: 84.7 bits (208), Expect = 8.2e-14 Identity = 42/89 (47.19%), Postives = 55/89 (61.80%), Query Frame = -2
BLAST of CU118224 vs. NCBI nr
Match: gi|747067547|ref|XP_011080500.1| (PREDICTED: F-box/WD-40 repeat-containing protein At5g21040-like [Sesamum indicum]) HSP 1 Score: 84.7 bits (208), Expect = 8.2e-14 Identity = 37/53 (69.81%), Postives = 45/53 (84.91%), Query Frame = -2
BLAST of CU118224 vs. NCBI nr
Match: gi|698558103|ref|XP_009771206.1| (PREDICTED: uncharacterized protein LOC104221776 [Nicotiana sylvestris]) HSP 1 Score: 83.6 bits (205), Expect = 1.8e-13 Identity = 40/56 (71.43%), Postives = 47/56 (83.93%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|