CU118155 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGTCAATTGACTGGGTACAATGGTGGCGAACCAGATGACGATGAAAGAAGATTTAATGAGAGACATGAACCTCTTCATTCTTTTTAAGCATGGATTTCGTGATTCTGATGGTGAGAGATACCGAAACAAGGGGGAGGATTGTTCTAGGCCATTTAGGTTTTGTGCAGAGGATGACCCAAGAATTTCATGGAAGAGAAGGTAGTCAGGGAGAAAGACTGAGTTAAGGATCTCTACCAAGGGAGTGGAGAATGCTTTTAGACTA
BLAST of CU118155 vs. TrEMBL
Match: A0A0A0KU39_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G504130 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 4.9e-16 Identity = 39/39 (100.00%), Postives = 39/39 (100.00%), Query Frame = 3
BLAST of CU118155 vs. TrEMBL
Match: A0A0A0KU39_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G504130 PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.2e-08 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 2
HSP 2 Score: 72.8 bits (177), Expect = 2.3e-10 Identity = 31/39 (79.49%), Postives = 33/39 (84.62%), Query Frame = 3
BLAST of CU118155 vs. TrEMBL
Match: A0A0A0KNM2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G503580 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 4.6e-06 Identity = 25/28 (89.29%), Postives = 26/28 (92.86%), Query Frame = 2
HSP 2 Score: 70.1 bits (170), Expect = 1.5e-09 Identity = 29/39 (74.36%), Postives = 34/39 (87.18%), Query Frame = 3
BLAST of CU118155 vs. TrEMBL
Match: A0A0A0KQR7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G503570 PE=4 SV=1) HSP 1 Score: 55.1 bits (131), Expect = 5.0e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 2
BLAST of CU118155 vs. NCBI nr
Match: gi|778703228|ref|XP_011655341.1| (PREDICTED: uncharacterized protein LOC101204083 [Cucumis sativus]) HSP 1 Score: 91.7 bits (226), Expect = 7.0e-16 Identity = 39/39 (100.00%), Postives = 39/39 (100.00%), Query Frame = 3
BLAST of CU118155 vs. NCBI nr
Match: gi|700196074|gb|KGN51251.1| (hypothetical protein Csa_5G504130 [Cucumis sativus]) HSP 1 Score: 91.7 bits (226), Expect = 7.0e-16 Identity = 39/39 (100.00%), Postives = 39/39 (100.00%), Query Frame = 3
BLAST of CU118155 vs. NCBI nr
Match: gi|659127120|ref|XP_008463536.1| (PREDICTED: uncharacterized protein LOC103501669 isoform X1 [Cucumis melo]) HSP 1 Score: 90.5 bits (223), Expect = 1.6e-15 Identity = 38/39 (97.44%), Postives = 39/39 (100.00%), Query Frame = 3
BLAST of CU118155 vs. NCBI nr
Match: gi|659127128|ref|XP_008463540.1| (PREDICTED: uncharacterized protein LOC103501669 isoform X2 [Cucumis melo]) HSP 1 Score: 90.5 bits (223), Expect = 1.6e-15 Identity = 38/39 (97.44%), Postives = 39/39 (100.00%), Query Frame = 3
BLAST of CU118155 vs. NCBI nr
Match: gi|659127134|ref|XP_008463543.1| (PREDICTED: uncharacterized protein LOC103501669 isoform X3 [Cucumis melo]) HSP 1 Score: 90.5 bits (223), Expect = 1.6e-15 Identity = 38/39 (97.44%), Postives = 39/39 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|