CU117907 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AACTATGACTATGAGAAGATTGAAGGCAGCTTAAAACCTTCAACGAACAAGAGAAAAGCCTGTGAAATGGTATGAAACTGACCTGAAGCTGAAGAATGATTTTCCCAAAGTTGGACGTAAGCTAGATGTGAAAGTCAGCATGGAAGAGCATGAAGTTCTCGTTGACATGCACTGTCCATATCGAGAATATATATTGGTCGATGTCATGGATGCTTTGAACGATTTGCAACTGGATGCCTACTC
BLAST of CU117907 vs. TrEMBL
Match: A0A0A0KCZ7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G003480 PE=4 SV=1) HSP 1 Score: 118.2 bits (295), Expect = 4.5e-24 Identity = 57/64 (89.06%), Postives = 59/64 (92.19%), Query Frame = 2
BLAST of CU117907 vs. TrEMBL
Match: A0A0A0KCZ7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G003480 PE=4 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 3.0e-04 Identity = 23/23 (100.00%), Postives = 23/23 (100.00%), Query Frame = 1
HSP 2 Score: 118.2 bits (295), Expect = 4.5e-24 Identity = 57/64 (89.06%), Postives = 59/64 (92.19%), Query Frame = 2
BLAST of CU117907 vs. TrEMBL
Match: I6N8K6_CUCSA (GL3 OS=Cucumis sativus PE=2 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 3.0e-04 Identity = 23/23 (100.00%), Postives = 23/23 (100.00%), Query Frame = 1
HSP 2 Score: 72.0 bits (175), Expect = 3.7e-10 Identity = 33/64 (51.56%), Postives = 48/64 (75.00%), Query Frame = 2
BLAST of CU117907 vs. TrEMBL
Match: A0A0A7W5E0_PRUAV (BHLH33 OS=Prunus avium GN=bHLH33 PE=2 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.4e-09 Identity = 32/56 (57.14%), Postives = 42/56 (75.00%), Query Frame = 2
BLAST of CU117907 vs. TrEMBL
Match: M5XIR9_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa002645mg PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.4e-09 Identity = 32/56 (57.14%), Postives = 42/56 (75.00%), Query Frame = 2
BLAST of CU117907 vs. NCBI nr
Match: gi|793421610|ref|NP_001292635.1| (transcription factor EGL1 [Cucumis sativus]) HSP 1 Score: 117.9 bits (294), Expect = 8.4e-24 Identity = 57/64 (89.06%), Postives = 59/64 (92.19%), Query Frame = 2
BLAST of CU117907 vs. NCBI nr
Match: gi|778709077|ref|XP_011656339.1| (PREDICTED: transcription factor EGL1 isoform X2 [Cucumis sativus]) HSP 1 Score: 117.9 bits (294), Expect = 8.4e-24 Identity = 57/64 (89.06%), Postives = 59/64 (92.19%), Query Frame = 2
BLAST of CU117907 vs. NCBI nr
Match: gi|700190452|gb|KGN45656.1| (hypothetical protein Csa_6G003480 [Cucumis sativus]) HSP 1 Score: 117.9 bits (294), Expect = 8.4e-24 Identity = 57/64 (89.06%), Postives = 59/64 (92.19%), Query Frame = 2
BLAST of CU117907 vs. NCBI nr
Match: gi|659116733|ref|XP_008458230.1| (PREDICTED: LOW QUALITY PROTEIN: transcription factor EGL1-like [Cucumis melo]) HSP 1 Score: 112.1 bits (279), Expect = 4.6e-22 Identity = 53/64 (82.81%), Postives = 58/64 (90.62%), Query Frame = 2
BLAST of CU117907 vs. NCBI nr
Match: gi|514482123|gb|AGO58373.1| (basic helix-loop-helix protein [Morella rubra]) HSP 1 Score: 71.6 bits (174), Expect = 6.9e-10 Identity = 33/64 (51.56%), Postives = 48/64 (75.00%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|