CU117898 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAATTATCCAGGTGGTGTGTTGTTTGATCCCTTGAATCTGTCCAAGGATGCTGAAGCCTTTGAGGAACTAAAAGTAAAAGAGATTAAAAATGGGCGTTTAGCCATGGTTGCCTGGCTAGGATTTTACAGTCAAGCTGCTTTGACGGGTAAGGGACCAGTCCAAAACCTTCTTGACCACATTGCAGATCCTTTCCACAATAACTTTCTTTCCCCGCTCAATTCTTCATTTAGTCGTTAATAACTGGAACCTGGATAAAGTATAGTGTCGTCAAATCTGTATAGTGTTCATAAGGG
BLAST of CU117898 vs. Swiss-Prot
Match: CB21_LEMGI (Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba PE=3 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 4.9e-18 Identity = 44/62 (70.97%), Postives = 48/62 (77.42%), Query Frame = 2
BLAST of CU117898 vs. Swiss-Prot
Match: CB23_TOBAC (Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum GN=CAB36 PE=3 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 4.9e-18 Identity = 43/62 (69.35%), Postives = 48/62 (77.42%), Query Frame = 2
BLAST of CU117898 vs. Swiss-Prot
Match: CB22_HORVU (Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare GN=CAB2 PE=3 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 6.4e-18 Identity = 44/62 (70.97%), Postives = 49/62 (79.03%), Query Frame = 2
BLAST of CU117898 vs. Swiss-Prot
Match: CB25_SOLLC (Chlorophyll a-b binding protein 5, chloroplastic (Fragment) OS=Solanum lycopersicum GN=CAB5 PE=2 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 6.4e-18 Identity = 44/62 (70.97%), Postives = 48/62 (77.42%), Query Frame = 2
BLAST of CU117898 vs. Swiss-Prot
Match: CB26_PETSP (Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. GN=CAB37 PE=3 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 6.4e-18 Identity = 43/62 (69.35%), Postives = 48/62 (77.42%), Query Frame = 2
BLAST of CU117898 vs. TrEMBL
Match: A0A0A0L0U5_CUCSA (Chlorophyll a-b binding protein, chloroplastic OS=Cucumis sativus GN=Csa_4G664570 PE=3 SV=1) HSP 1 Score: 129.0 bits (323), Expect = 3.1e-27 Identity = 62/63 (98.41%), Postives = 62/63 (98.41%), Query Frame = 2
BLAST of CU117898 vs. TrEMBL
Match: A0A061EWX0_THECC (Chlorophyll a-b binding protein, chloroplastic OS=Theobroma cacao GN=TCM_024723 PE=3 SV=1) HSP 1 Score: 123.2 bits (308), Expect = 1.7e-25 Identity = 58/63 (92.06%), Postives = 61/63 (96.83%), Query Frame = 2
BLAST of CU117898 vs. TrEMBL
Match: W9QWP9_9ROSA (Chlorophyll a-b binding protein, chloroplastic OS=Morus notabilis GN=L484_024786 PE=3 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 2.9e-25 Identity = 56/63 (88.89%), Postives = 60/63 (95.24%), Query Frame = 2
BLAST of CU117898 vs. TrEMBL
Match: C6TAC2_SOYBN (Chlorophyll a-b binding protein, chloroplastic OS=Glycine max GN=GLYMA_17G262400 PE=2 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 4.9e-25 Identity = 57/63 (90.48%), Postives = 59/63 (93.65%), Query Frame = 2
BLAST of CU117898 vs. TrEMBL
Match: A0A0V0IK43_SOLCH (Chlorophyll a-b binding protein, chloroplastic OS=Solanum chacoense PE=3 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 4.9e-25 Identity = 58/63 (92.06%), Postives = 60/63 (95.24%), Query Frame = 2
BLAST of CU117898 vs. NCBI nr
Match: gi|449455655|ref|XP_004145567.1| (PREDICTED: chlorophyll a-b binding protein of LHCII type 1-like isoform X1 [Cucumis sativus]) HSP 1 Score: 131.3 bits (329), Expect = 8.9e-28 Identity = 62/63 (98.41%), Postives = 62/63 (98.41%), Query Frame = 2
BLAST of CU117898 vs. NCBI nr
Match: gi|778697301|ref|XP_011654292.1| (PREDICTED: chlorophyll a-b binding protein of LHCII type 1-like isoform X2 [Cucumis sativus]) HSP 1 Score: 131.3 bits (329), Expect = 8.9e-28 Identity = 62/63 (98.41%), Postives = 62/63 (98.41%), Query Frame = 2
BLAST of CU117898 vs. NCBI nr
Match: gi|700200392|gb|KGN55550.1| (hypothetical protein Csa_4G664570 [Cucumis sativus]) HSP 1 Score: 131.3 bits (329), Expect = 8.9e-28 Identity = 62/63 (98.41%), Postives = 62/63 (98.41%), Query Frame = 2
BLAST of CU117898 vs. NCBI nr
Match: gi|659105213|ref|XP_008453033.1| (PREDICTED: chlorophyll a-b binding protein of LHCII type 1 isoform X2 [Cucumis melo]) HSP 1 Score: 130.2 bits (326), Expect = 2.0e-27 Identity = 61/63 (96.83%), Postives = 62/63 (98.41%), Query Frame = 2
BLAST of CU117898 vs. NCBI nr
Match: gi|659105211|ref|XP_008453032.1| (PREDICTED: chlorophyll a-b binding protein of LHCII type 1 isoform X1 [Cucumis melo]) HSP 1 Score: 130.2 bits (326), Expect = 2.0e-27 Identity = 61/63 (96.83%), Postives = 62/63 (98.41%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|