CU117873 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAAATCAGGTTGGTTGTGTAGTGTTTTTGTTGGGAGTGCGATTGTTGATATGTATGCAAAAAATTACTTTTGATTTATGATGCCGTTGAAGTGTTTGATGAAATGCCCATGAAGAATACTGTGTGTGCAAATGCATTGCTGGCTGGGTATGGCGAGGCTAGGATGTGGGTTGAAGGACTTGAATTGCTACGGAAGATGCAGG
BLAST of CU117873 vs. TrEMBL
Match: A0A0A0LLD6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258600 PE=4 SV=1) HSP 1 Score: 92.4 bits (228), Expect = 2.2e-16 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = 2
BLAST of CU117873 vs. TrEMBL
Match: A0A0A0LLD6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258600 PE=4 SV=1) HSP 1 Score: 47.8 bits (112), Expect = 6.2e-03 Identity = 21/21 (100.00%), Postives = 21/21 (100.00%), Query Frame = 3
HSP 2 Score: 75.5 bits (184), Expect = 2.8e-11 Identity = 34/47 (72.34%), Postives = 42/47 (89.36%), Query Frame = 2
BLAST of CU117873 vs. TrEMBL
Match: D7U5E6_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_03s0038g01070 PE=4 SV=1) HSP 1 Score: 40.8 bits (94), Expect = 7.6e-01 Identity = 18/20 (90.00%), Postives = 19/20 (95.00%), Query Frame = 3
HSP 2 Score: 70.5 bits (171), Expect = 8.9e-10 Identity = 32/44 (72.73%), Postives = 39/44 (88.64%), Query Frame = 2
BLAST of CU117873 vs. TrEMBL
Match: A0A0K9R2F1_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_114500 PE=4 SV=1) HSP 1 Score: 29.6 bits (65), Expect = 1.7e+03 Identity = 11/21 (52.38%), Postives = 17/21 (80.95%), Query Frame = 3
HSP 2 Score: 68.6 bits (166), Expect = 3.4e-09 Identity = 31/47 (65.96%), Postives = 40/47 (85.11%), Query Frame = 2
BLAST of CU117873 vs. TrEMBL
Match: V4SD86_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10030191mg PE=4 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 7.6e-09 Identity = 31/46 (67.39%), Postives = 40/46 (86.96%), Query Frame = 2
BLAST of CU117873 vs. NCBI nr
Match: gi|659115574|ref|XP_008457622.1| (PREDICTED: pentatricopeptide repeat-containing protein At2g13600-like [Cucumis melo]) HSP 1 Score: 93.6 bits (231), Expect = 1.4e-16 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = 2
BLAST of CU117873 vs. NCBI nr
Match: gi|449458644|ref|XP_004147057.1| (PREDICTED: pentatricopeptide repeat-containing protein DOT4, chloroplastic-like [Cucumis sativus]) HSP 1 Score: 93.6 bits (231), Expect = 1.4e-16 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = 2
BLAST of CU117873 vs. NCBI nr
Match: gi|297744703|emb|CBI37965.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 76.6 bits (187), Expect = 1.8e-11 Identity = 34/47 (72.34%), Postives = 42/47 (89.36%), Query Frame = 2
BLAST of CU117873 vs. NCBI nr
Match: gi|731383046|ref|XP_010647512.1| (PREDICTED: pentatricopeptide repeat-containing protein At2g13600-like isoform X1 [Vitis vinifera]) HSP 1 Score: 76.6 bits (187), Expect = 1.8e-11 Identity = 34/47 (72.34%), Postives = 42/47 (89.36%), Query Frame = 2
BLAST of CU117873 vs. NCBI nr
Match: gi|1009149489|ref|XP_015892506.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g12770-like [Ziziphus jujuba]) HSP 1 Score: 75.1 bits (183), Expect = 5.2e-11 Identity = 34/46 (73.91%), Postives = 41/46 (89.13%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|