CU117837 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGTAGCCACATCCACGGAAGATAAGTCGCCGCTCAACGTATCATCCTGAATGCGAAGGTAGTTGTCTTCACAATGAAGGGCTTGAAAAAATGACAGAAAGATGAAAATCCACCATATCAGAACTTGCTTGTGAAAAGACGTCGATTATTGGGGTGGAACCGCCGTTGGTTAACCAGTCCAACATCCC
BLAST of CU117837 vs. Swiss-Prot
Match: PLP2_ARATH (Patatin-like protein 2 OS=Arabidopsis thaliana GN=PLP2 PE=1 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.7e-08 Identity = 26/34 (76.47%), Postives = 28/34 (82.35%), Query Frame = -1
HSP 2 Score: 44.3 bits (103), Expect = 5.7e-04 Identity = 19/27 (70.37%), Postives = 22/27 (81.48%), Query Frame = -2
BLAST of CU117837 vs. Swiss-Prot
Match: PLP2_ORYSI (Patatin-like protein 2 OS=Oryza sativa subsp. indica GN=PLP2 PE=3 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 6.1e-06 Identity = 21/36 (58.33%), Postives = 26/36 (72.22%), Query Frame = -1
HSP 2 Score: 34.3 bits (77), Expect = 5.9e-01 Identity = 15/24 (62.50%), Postives = 15/24 (62.50%), Query Frame = -2
BLAST of CU117837 vs. Swiss-Prot
Match: PLP2_ORYSJ (Patatin-like protein 2 OS=Oryza sativa subsp. japonica GN=PLP2 PE=3 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 6.1e-06 Identity = 21/36 (58.33%), Postives = 26/36 (72.22%), Query Frame = -1
HSP 2 Score: 34.3 bits (77), Expect = 5.9e-01 Identity = 15/24 (62.50%), Postives = 15/24 (62.50%), Query Frame = -2
BLAST of CU117837 vs. TrEMBL
Match: A0A0A0LKY1_CUCSA (Patatin OS=Cucumis sativus GN=Csa_2G360570 PE=3 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 1.3e-10 Identity = 34/36 (94.44%), Postives = 35/36 (97.22%), Query Frame = -1
BLAST of CU117837 vs. TrEMBL
Match: A0A0A0LKY1_CUCSA (Patatin OS=Cucumis sativus GN=Csa_2G360570 PE=3 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 4.3e-06 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = -2
HSP 2 Score: 64.7 bits (156), Expect = 4.5e-08 Identity = 27/36 (75.00%), Postives = 34/36 (94.44%), Query Frame = -1
BLAST of CU117837 vs. TrEMBL
Match: M5XD94_PRUPE (Patatin OS=Prunus persica GN=PRUPE_ppa006466mg PE=3 SV=1) HSP 1 Score: 47.0 bits (110), Expect = 9.8e-03 Identity = 21/27 (77.78%), Postives = 25/27 (92.59%), Query Frame = -2
HSP 2 Score: 64.3 bits (155), Expect = 5.9e-08 Identity = 28/36 (77.78%), Postives = 33/36 (91.67%), Query Frame = -1
BLAST of CU117837 vs. TrEMBL
Match: A0A068URZ4_COFCA (Patatin OS=Coffea canephora GN=GSCOC_T00033092001 PE=3 SV=1) HSP 1 Score: 45.8 bits (107), Expect = 2.2e-02 Identity = 21/27 (77.78%), Postives = 24/27 (88.89%), Query Frame = -2
HSP 2 Score: 64.3 bits (155), Expect = 5.9e-08 Identity = 28/36 (77.78%), Postives = 33/36 (91.67%), Query Frame = -1
BLAST of CU117837 vs. TrEMBL
Match: A0A068URB8_COFCA (Patatin OS=Coffea canephora GN=GSCOC_T00033097001 PE=3 SV=1) HSP 1 Score: 45.8 bits (107), Expect = 2.2e-02 Identity = 21/27 (77.78%), Postives = 24/27 (88.89%), Query Frame = -2
HSP 2 Score: 63.9 bits (154), Expect = 7.7e-08 Identity = 27/36 (75.00%), Postives = 33/36 (91.67%), Query Frame = -1
BLAST of CU117837 vs. NCBI nr
Match: gi|449470176|ref|XP_004152794.1| (PREDICTED: patatin-like protein 2 [Cucumis sativus]) HSP 1 Score: 73.6 bits (179), Expect = 1.4e-10 Identity = 34/36 (94.44%), Postives = 35/36 (97.22%), Query Frame = -1
BLAST of CU117837 vs. NCBI nr
Match: gi|700207421|gb|KGN62540.1| (hypothetical protein Csa_2G360570 [Cucumis sativus]) HSP 1 Score: 73.6 bits (179), Expect = 1.4e-10 Identity = 34/36 (94.44%), Postives = 35/36 (97.22%), Query Frame = -1
BLAST of CU117837 vs. NCBI nr
Match: gi|659087800|ref|XP_008444643.1| (PREDICTED: patatin-like protein 2 [Cucumis melo]) HSP 1 Score: 71.2 bits (173), Expect = 7.0e-10 Identity = 33/36 (91.67%), Postives = 34/36 (94.44%), Query Frame = -1
BLAST of CU117837 vs. NCBI nr
Match: gi|694382777|ref|XP_009367378.1| (PREDICTED: patatin-like protein 2 [Pyrus x bretschneideri]) HSP 1 Score: 66.2 bits (160), Expect = 2.2e-08 Identity = 28/36 (77.78%), Postives = 34/36 (94.44%), Query Frame = -1
BLAST of CU117837 vs. NCBI nr
Match: gi|658002656|ref|XP_008393827.1| (PREDICTED: patatin-like protein 2 isoform X1 [Malus domestica]) HSP 1 Score: 66.2 bits (160), Expect = 2.2e-08 Identity = 28/36 (77.78%), Postives = 34/36 (94.44%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|