CU117831 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCTTATCAGGGAAGCCAACACAAGGTTCATTGGATATTGTTCTGAAGCTTTTGAGGAACATAGTTCGGGAACCAGAGAATTCAAAATTTAGGAAGATTCGTCTGAGTAATCCCAAAAATTAAGGAGGCAATTGGTGAGGCTGTTGGGGGAGTGGAATTGTTGGAGTTTGTGGGTTTTAAATTGCAAGAGGA
BLAST of CU117831 vs. Swiss-Prot
Match: PUX2_ARATH (Plant UBX domain-containing protein 2 OS=Arabidopsis thaliana GN=PUX2 PE=1 SV=2) HSP 1 Score: 60.5 bits (145), Expect = 7.9e-09 Identity = 24/39 (61.54%), Postives = 34/39 (87.18%), Query Frame = 1
HSP 2 Score: 41.6 bits (96), Expect = 3.8e-03 Identity = 19/25 (76.00%), Postives = 20/25 (80.00%), Query Frame = 2
BLAST of CU117831 vs. TrEMBL
Match: A0A0A0KUN7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G545560 PE=4 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 1.8e-12 Identity = 39/39 (100.00%), Postives = 39/39 (100.00%), Query Frame = 1
BLAST of CU117831 vs. TrEMBL
Match: A0A0A0KUN7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G545560 PE=4 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 8.1e-05 Identity = 26/26 (100.00%), Postives = 26/26 (100.00%), Query Frame = 2
HSP 2 Score: 67.4 bits (163), Expect = 7.2e-09 Identity = 27/39 (69.23%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CU117831 vs. TrEMBL
Match: A0A068TXP8_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00032933001 PE=4 SV=1) HSP 1 Score: 43.9 bits (102), Expect = 8.4e-02 Identity = 21/26 (80.77%), Postives = 22/26 (84.62%), Query Frame = 2
HSP 2 Score: 67.0 bits (162), Expect = 9.4e-09 Identity = 29/39 (74.36%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of CU117831 vs. TrEMBL
Match: A0A151T3B8_CAJCA (UBX domain-containing protein 6 OS=Cajanus cajan GN=KK1_016033 PE=4 SV=1) HSP 1 Score: 44.3 bits (103), Expect = 6.5e-02 Identity = 19/26 (73.08%), Postives = 23/26 (88.46%), Query Frame = 2
HSP 2 Score: 66.6 bits (161), Expect = 1.2e-08 Identity = 29/39 (74.36%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of CU117831 vs. TrEMBL
Match: A0A0D2SHX6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G158800 PE=4 SV=1) HSP 1 Score: 47.0 bits (110), Expect = 1.0e-02 Identity = 21/26 (80.77%), Postives = 24/26 (92.31%), Query Frame = 2
HSP 2 Score: 66.6 bits (161), Expect = 1.2e-08 Identity = 29/39 (74.36%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of CU117831 vs. NCBI nr
Match: gi|778703847|ref|XP_011655442.1| (PREDICTED: UBX domain-containing protein 6 [Cucumis sativus]) HSP 1 Score: 79.3 bits (194), Expect = 2.6e-12 Identity = 39/39 (100.00%), Postives = 39/39 (100.00%), Query Frame = 1
BLAST of CU117831 vs. NCBI nr
Match: gi|659072806|ref|XP_008467106.1| (PREDICTED: UBX domain-containing protein 6 [Cucumis melo]) HSP 1 Score: 76.6 bits (187), Expect = 1.7e-11 Identity = 37/39 (94.87%), Postives = 39/39 (100.00%), Query Frame = 1
BLAST of CU117831 vs. NCBI nr
Match: gi|502138337|ref|XP_004503367.1| (PREDICTED: plant UBX domain-containing protein 2 [Cicer arietinum]) HSP 1 Score: 68.9 bits (167), Expect = 3.6e-09 Identity = 30/39 (76.92%), Postives = 38/39 (97.44%), Query Frame = 1
BLAST of CU117831 vs. NCBI nr
Match: gi|1012100499|ref|XP_015957231.1| (PREDICTED: plant UBX domain-containing protein 2 [Arachis duranensis]) HSP 1 Score: 67.8 bits (164), Expect = 7.9e-09 Identity = 29/39 (74.36%), Postives = 38/39 (97.44%), Query Frame = 1
BLAST of CU117831 vs. NCBI nr
Match: gi|661896254|emb|CDP00832.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 67.4 bits (163), Expect = 1.0e-08 Identity = 27/39 (69.23%), Postives = 37/39 (94.87%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|