CU117691 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GATCACTTGCTTTAATCCTGGTTCCTTCACAAATGATAGCACTTTTGTGGCATATCGTCCATGCAATCAAGAAGTTGAACTGTCTGCCCTGTAAATTATTACAAAGTTTAGGCCAGATTCAAGCGGGCACACTCCTTTATGCAGCATAACAATTCGTTTAGAACATGAATGAGAAATCCTATAGCATCATTCTTTATCTTGGGAGTTGCACTATTCTTTATCTTGGGGAGTTGCACTGGTGCACACCAAGAATTACCACTAGCTAGAATCTAACTCTATGCCGAAGAAG
BLAST of CU117691 vs. Swiss-Prot
Match: DPB2_ARATH (DNA polymerase epsilon subunit B OS=Arabidopsis thaliana GN=DPB2 PE=1 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.8e-07 Identity = 25/29 (86.21%), Postives = 24/29 (82.76%), Query Frame = 2
BLAST of CU117691 vs. TrEMBL
Match: A0A0A0LX08_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G435200 PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.4e-08 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of CU117691 vs. TrEMBL
Match: M1D2B5_SOLTU (DNA polymerase epsilon subunit 2 OS=Solanum tuberosum GN=PGSC0003DMG400031043 PE=3 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.6e-07 Identity = 27/30 (90.00%), Postives = 29/30 (96.67%), Query Frame = 2
BLAST of CU117691 vs. TrEMBL
Match: M1D2B7_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400031043 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.6e-07 Identity = 27/30 (90.00%), Postives = 29/30 (96.67%), Query Frame = 2
BLAST of CU117691 vs. TrEMBL
Match: M1D2B3_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400031043 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.6e-07 Identity = 27/30 (90.00%), Postives = 29/30 (96.67%), Query Frame = 2
BLAST of CU117691 vs. TrEMBL
Match: A0A0V0GIJ1_SOLCH (Putative ovule protein (Fragment) OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.6e-07 Identity = 27/30 (90.00%), Postives = 29/30 (96.67%), Query Frame = 2
BLAST of CU117691 vs. NCBI nr
Match: gi|778660923|ref|XP_011657177.1| (PREDICTED: DNA polymerase epsilon subunit 2 [Cucumis sativus]) HSP 1 Score: 68.2 bits (165), Expect = 9.1e-09 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of CU117691 vs. NCBI nr
Match: gi|700210428|gb|KGN65524.1| (hypothetical protein Csa_1G435200 [Cucumis sativus]) HSP 1 Score: 68.2 bits (165), Expect = 9.1e-09 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of CU117691 vs. NCBI nr
Match: gi|659066275|ref|XP_008463560.1| (PREDICTED: LOW QUALITY PROTEIN: DNA polymerase epsilon subunit 2 [Cucumis melo]) HSP 1 Score: 68.2 bits (165), Expect = 9.1e-09 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of CU117691 vs. NCBI nr
Match: gi|970013889|ref|XP_015067925.1| (PREDICTED: DNA polymerase epsilon subunit 2 isoform X1 [Solanum pennellii]) HSP 1 Score: 64.7 bits (156), Expect = 1.0e-07 Identity = 27/30 (90.00%), Postives = 29/30 (96.67%), Query Frame = 2
BLAST of CU117691 vs. NCBI nr
Match: gi|460379267|ref|XP_004235385.1| (PREDICTED: DNA polymerase epsilon subunit 2 [Solanum lycopersicum]) HSP 1 Score: 64.7 bits (156), Expect = 1.0e-07 Identity = 27/30 (90.00%), Postives = 29/30 (96.67%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|