CU117601 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATCCTAATGTTCATGTCGATCCTTACTTCGCGCTACGCAGAAGATGATTTTATAGCATTCATTGCCATCAAGATTGCTCTTTGGACTGGCGACGTTATTCATATCCATCGTGTGCATGGTTGTGGCCTTTAGTGCTACCTTTTTTATTCTCTACCATAAGGCTAACATATGTATTCCCACCATAGTGTCTGCCATGGCGATTCTTCCAGTTATTTGTTTTTGTGTCCTTCAGTGTAAACTGTGGGCTGATATTTT
BLAST of CU117601 vs. TrEMBL
Match: A0A0A0LRT6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G058080 PE=4 SV=1) HSP 1 Score: 136.7 bits (343), Expect = 1.3e-29 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of CU117601 vs. TrEMBL
Match: A0A0A0KRV4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G174620 PE=4 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 2.9e-18 Identity = 48/67 (71.64%), Postives = 54/67 (80.60%), Query Frame = 2
BLAST of CU117601 vs. TrEMBL
Match: A0A0A0LUL7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G058070 PE=4 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 7.3e-17 Identity = 43/65 (66.15%), Postives = 50/65 (76.92%), Query Frame = 2
BLAST of CU117601 vs. TrEMBL
Match: A0A0A0LWX0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G058110 PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 6.1e-16 Identity = 42/65 (64.62%), Postives = 52/65 (80.00%), Query Frame = 2
BLAST of CU117601 vs. TrEMBL
Match: A0A0A0LU19_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G058090 PE=4 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 1.0e-15 Identity = 42/65 (64.62%), Postives = 53/65 (81.54%), Query Frame = 2
BLAST of CU117601 vs. NCBI nr
Match: gi|778658304|ref|XP_011652468.1| (PREDICTED: uncharacterized protein LOC101218503 isoform X1 [Cucumis sativus]) HSP 1 Score: 127.9 bits (320), Expect = 8.5e-27 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of CU117601 vs. NCBI nr
Match: gi|449454915|ref|XP_004145199.1| (PREDICTED: uncharacterized protein LOC101215460 [Cucumis sativus]) HSP 1 Score: 95.9 bits (237), Expect = 3.6e-17 Identity = 48/66 (72.73%), Postives = 58/66 (87.88%), Query Frame = 2
BLAST of CU117601 vs. NCBI nr
Match: gi|659067663|ref|XP_008440640.1| (PREDICTED: uncharacterized protein LOC103484989 isoform X2 [Cucumis melo]) HSP 1 Score: 95.5 bits (236), Expect = 4.7e-17 Identity = 47/66 (71.21%), Postives = 58/66 (87.88%), Query Frame = 2
BLAST of CU117601 vs. NCBI nr
Match: gi|659067661|ref|XP_008440631.1| (PREDICTED: uncharacterized protein LOC103484989 isoform X1 [Cucumis melo]) HSP 1 Score: 95.5 bits (236), Expect = 4.7e-17 Identity = 47/66 (71.21%), Postives = 58/66 (87.88%), Query Frame = 2
BLAST of CU117601 vs. NCBI nr
Match: gi|700195259|gb|KGN50436.1| (hypothetical protein Csa_5G174620 [Cucumis sativus]) HSP 1 Score: 90.1 bits (222), Expect = 2.0e-15 Identity = 48/67 (71.64%), Postives = 54/67 (80.60%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|