CU117542 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGATTGGGTTTGGGGATTAGTCCCTCATGATACCACCGTTGCCAGTACATCAGGCTCAGATGTATATGTTTGGGATACCAATAGTGGGGAATTGGCTACTGTCATTCATGAGGCTCATGTTGGCTATGCTTATGCCCTTGCGCGAAGCCATACAGGGGACTTTCTATTTACTGGAGGGGAAGATGGTGCTATTCACATGTTTGATATAACCAATCGTCATGTCGATACAAGTGCTCAACTGGTTGGATCTTGGATTCCT
BLAST of CU117542 vs. Swiss-Prot
Match: FBW3_ARATH (F-box/WD-40 repeat-containing protein At5g21040 OS=Arabidopsis thaliana GN=At5g21040 PE=2 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 8.9e-27 Identity = 53/86 (61.63%), Postives = 62/86 (72.09%), Query Frame = 3
BLAST of CU117542 vs. TrEMBL
Match: A0A0A0L0C6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G269200 PE=4 SV=1) HSP 1 Score: 188.3 bits (477), Expect = 3.9e-45 Identity = 87/87 (100.00%), Postives = 87/87 (100.00%), Query Frame = 3
BLAST of CU117542 vs. TrEMBL
Match: A0A0B2S1A0_GLYSO (F-box/WD-40 repeat-containing protein OS=Glycine soja GN=glysoja_004108 PE=4 SV=1) HSP 1 Score: 144.1 bits (362), Expect = 8.4e-32 Identity = 64/86 (74.42%), Postives = 71/86 (82.56%), Query Frame = 3
BLAST of CU117542 vs. TrEMBL
Match: A0A151U1T0_CAJCA (F-box/WD-40 repeat-containing protein At5g21040 family OS=Cajanus cajan GN=KK1_005791 PE=4 SV=1) HSP 1 Score: 143.7 bits (361), Expect = 1.1e-31 Identity = 63/86 (73.26%), Postives = 72/86 (83.72%), Query Frame = 3
BLAST of CU117542 vs. TrEMBL
Match: K7KB35_SOYBN (Uncharacterized protein OS=Glycine max PE=4 SV=1) HSP 1 Score: 142.1 bits (357), Expect = 3.2e-31 Identity = 63/86 (73.26%), Postives = 71/86 (82.56%), Query Frame = 3
BLAST of CU117542 vs. TrEMBL
Match: I1JIQ1_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_02G273700 PE=4 SV=2) HSP 1 Score: 142.1 bits (357), Expect = 3.2e-31 Identity = 63/86 (73.26%), Postives = 71/86 (82.56%), Query Frame = 3
BLAST of CU117542 vs. NCBI nr
Match: gi|778692827|ref|XP_011653530.1| (PREDICTED: F-box/WD-40 repeat-containing protein At5g21040 [Cucumis sativus]) HSP 1 Score: 188.3 bits (477), Expect = 5.5e-45 Identity = 87/87 (100.00%), Postives = 87/87 (100.00%), Query Frame = 3
BLAST of CU117542 vs. NCBI nr
Match: gi|659097885|ref|XP_008449867.1| (PREDICTED: F-box/WD-40 repeat-containing protein At5g21040 [Cucumis melo]) HSP 1 Score: 186.4 bits (472), Expect = 2.1e-44 Identity = 85/87 (97.70%), Postives = 87/87 (100.00%), Query Frame = 3
BLAST of CU117542 vs. NCBI nr
Match: gi|734416564|gb|KHN38443.1| (F-box/WD-40 repeat-containing protein [Glycine soja]) HSP 1 Score: 144.4 bits (363), Expect = 9.2e-32 Identity = 64/86 (74.42%), Postives = 71/86 (82.56%), Query Frame = 3
BLAST of CU117542 vs. NCBI nr
Match: gi|1012361995|gb|KYP73178.1| (F-box/WD-40 repeat-containing protein At5g21040 family [Cajanus cajan]) HSP 1 Score: 144.1 bits (362), Expect = 1.2e-31 Identity = 63/86 (73.26%), Postives = 72/86 (83.72%), Query Frame = 3
BLAST of CU117542 vs. NCBI nr
Match: gi|571507141|ref|XP_006595810.1| (PREDICTED: F-box/WD-40 repeat-containing protein At5g21040-like [Glycine max]) HSP 1 Score: 142.5 bits (358), Expect = 3.5e-31 Identity = 63/86 (73.26%), Postives = 71/86 (82.56%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|