CU117322 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATGATTTCTATGACCAACCTGCTTCCATGGCGCAAGAAAGGTTTGAGATGAATGATGTGGAAGTCCAGGTGGAAGGCGTGTCTGTATGTAGGTAGTTGACTGGAAGATCAACGGTTGAGAATTGCGGATTCTGGACCTCTCGAAATCCAAATCCAATATCTGCGGCTGAGAAAGGAAACCACGAGCTTCACAAAAACCAATTAAGTGTGTGTGTGAAGGCGAGTGTGGCGGTTGTGAGCCGGCAGCGGAGGCGGGAAGGGTAGGGATG
BLAST of CU117322 vs. TrEMBL
Match: A0A0A0KKB0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G502010 PE=4 SV=1) HSP 1 Score: 164.1 bits (414), Expect = 7.9e-38 Identity = 78/78 (100.00%), Postives = 78/78 (100.00%), Query Frame = -2
BLAST of CU117322 vs. NCBI nr
Match: gi|700193608|gb|KGN48812.1| (hypothetical protein Csa_6G502010 [Cucumis sativus]) HSP 1 Score: 164.1 bits (414), Expect = 1.1e-37 Identity = 78/78 (100.00%), Postives = 78/78 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|