CU117262 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCATTTTGTAACAGGAAAAACAAATAAGCATCGACGGCTTTGGACATTTCGACAAACAAATCCAAGTGGGTTTGAGGTAAAGGCACATTTTCATCAGCCTTTTCAAACTCAACAGTCCATTTCTGCAAAGCTTTCTCCTATTTCGTTTGATCTTCCATTAACAGCTTCAACCCTTGCTCTAAGCATTTTGTAATAGTTTAGCATATCTCCTTCAACAGCTTCATAGACTATGCATTTCTTAGCATCATCTGCAACTTTTATTAACCATTTTTCTGATACAACTTGATCTCCAAGATG
BLAST of CU117262 vs. TrEMBL
Match: A0A0A0M0E1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G680110 PE=4 SV=1) HSP 1 Score: 121.3 bits (303), Expect = 6.5e-25 Identity = 59/59 (100.00%), Postives = 59/59 (100.00%), Query Frame = -1
BLAST of CU117262 vs. TrEMBL
Match: A0A0A0M0E1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G680110 PE=4 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 2.7e-10 Identity = 33/39 (84.62%), Postives = 36/39 (92.31%), Query Frame = -2
HSP 2 Score: 87.0 bits (214), Expect = 1.4e-14 Identity = 42/61 (68.85%), Postives = 53/61 (86.89%), Query Frame = -1
BLAST of CU117262 vs. TrEMBL
Match: A0A0A0LAY7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G342350 PE=4 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 2.6e-05 Identity = 22/33 (66.67%), Postives = 30/33 (90.91%), Query Frame = -2
HSP 2 Score: 63.2 bits (152), Expect = 2.1e-07 Identity = 28/51 (54.90%), Postives = 39/51 (76.47%), Query Frame = -1
BLAST of CU117262 vs. TrEMBL
Match: N0DK19_CUCPE (Major latex-like protein OS=Cucurbita pepo subsp. pepo GN=MLP-GR1 PE=2 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 2.2e-04 Identity = 23/33 (69.70%), Postives = 29/33 (87.88%), Query Frame = -2
HSP 2 Score: 63.2 bits (152), Expect = 2.1e-07 Identity = 28/51 (54.90%), Postives = 39/51 (76.47%), Query Frame = -1
BLAST of CU117262 vs. TrEMBL
Match: N0DKL1_CUCPE (Major latex-like protein OS=Cucurbita pepo subsp. ovifera GN=MLP-PG1 PE=2 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 2.2e-04 Identity = 23/33 (69.70%), Postives = 29/33 (87.88%), Query Frame = -2
HSP 2 Score: 62.8 bits (151), Expect = 2.8e-07 Identity = 28/46 (60.87%), Postives = 37/46 (80.43%), Query Frame = -1
BLAST of CU117262 vs. NCBI nr
Match: gi|449449571|ref|XP_004142538.1| (PREDICTED: kirola-like [Cucumis sativus]) HSP 1 Score: 124.4 bits (311), Expect = 1.1e-25 Identity = 59/59 (100.00%), Postives = 59/59 (100.00%), Query Frame = -1
BLAST of CU117262 vs. NCBI nr
Match: gi|659086152|ref|XP_008443791.1| (PREDICTED: kirola-like [Cucumis melo]) HSP 1 Score: 108.6 bits (270), Expect = 6.3e-21 Identity = 48/59 (81.36%), Postives = 55/59 (93.22%), Query Frame = -1
BLAST of CU117262 vs. NCBI nr
Match: gi|778688605|ref|XP_004149788.2| (PREDICTED: kirola-like [Cucumis sativus]) HSP 1 Score: 90.1 bits (222), Expect = 2.3e-15 Identity = 42/61 (68.85%), Postives = 53/61 (86.89%), Query Frame = -1
BLAST of CU117262 vs. NCBI nr
Match: gi|700202699|gb|KGN57832.1| (hypothetical protein Csa_3G342350 [Cucumis sativus]) HSP 1 Score: 90.1 bits (222), Expect = 2.3e-15 Identity = 42/61 (68.85%), Postives = 53/61 (86.89%), Query Frame = -1
BLAST of CU117262 vs. NCBI nr
Match: gi|659114461|ref|XP_008457062.1| (PREDICTED: MLP-like protein 423 [Cucumis melo]) HSP 1 Score: 65.1 bits (157), Expect = 8.0e-08 Identity = 29/59 (49.15%), Postives = 43/59 (72.88%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|