CU116875 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCCGAGCATCGTCTTCACTTTGTCCATCTCTAGCAACAAGTCGTTGAAGCTGTGTTTCAGAATCCACCCCATGCAACAATTGTTGGTTTTGTCCATCTGTCCATCTTGGCTTCAAATAGTAAAGGGATATCAAGCACTATAACCTTGTAACCTTTCATCCATAACTTCACTATCTTCCATAAGATTCCAGAGGATATGTATGGAGCTAATAATTGATTTAAAAGTTTCCGCTTTGCAGGATCAGACAAAAACAATTTGGCCCAGTTT
BLAST of CU116875 vs. Swiss-Prot
Match: COAE_ORYSJ (Dephospho-CoA kinase OS=Oryza sativa subsp. japonica GN=Os01g0360600 PE=2 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 2.1e-20 Identity = 44/63 (69.84%), Postives = 52/63 (82.54%), Query Frame = -2
BLAST of CU116875 vs. Swiss-Prot
Match: COAE_ARATH (Dephospho-CoA kinase OS=Arabidopsis thaliana GN=COAE PE=2 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.0e-18 Identity = 40/63 (63.49%), Postives = 49/63 (77.78%), Query Frame = -2
HSP 2 Score: 33.1 bits (74), Expect = 1.9e+00 Identity = 15/22 (68.18%), Postives = 16/22 (72.73%), Query Frame = -3
BLAST of CU116875 vs. Swiss-Prot
Match: YNP5_CAEEL (Uncharacterized protein T05G5.5 OS=Caenorhabditis elegans GN=T05G5.5 PE=3 SV=2) HSP 1 Score: 55.1 bits (131), Expect = 4.6e-07 Identity = 29/66 (43.94%), Postives = 35/66 (53.03%), Query Frame = -2
BLAST of CU116875 vs. Swiss-Prot
Match: YJL1_SCHPO (Uncharacterized protein C14G10.01 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=SPCC14G10.01 PE=1 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 5.1e-06 Identity = 24/58 (41.38%), Postives = 37/58 (63.79%), Query Frame = -2
BLAST of CU116875 vs. TrEMBL
Match: A0A0A0KV42_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G001520 PE=3 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 2.0e-25 Identity = 57/63 (90.48%), Postives = 60/63 (95.24%), Query Frame = -2
BLAST of CU116875 vs. TrEMBL
Match: A0A0A0KV42_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G001520 PE=3 SV=1) HSP 1 Score: 47.0 bits (110), Expect = 1.4e-02 Identity = 25/35 (71.43%), Postives = 27/35 (77.14%), Query Frame = -3
HSP 2 Score: 107.5 bits (267), Expect = 8.8e-21 Identity = 49/63 (77.78%), Postives = 55/63 (87.30%), Query Frame = -2
BLAST of CU116875 vs. TrEMBL
Match: W9QWR5_9ROSA (Dephospho-CoA kinase domain-containing protein OS=Morus notabilis GN=L484_009080 PE=3 SV=1) HSP 1 Score: 39.3 bits (90), Expect = 2.9e+00 Identity = 18/22 (81.82%), Postives = 20/22 (90.91%), Query Frame = -3
HSP 2 Score: 105.9 bits (263), Expect = 2.6e-20 Identity = 46/63 (73.02%), Postives = 57/63 (90.48%), Query Frame = -2
BLAST of CU116875 vs. TrEMBL
Match: M5VMN9_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa010823mg PE=3 SV=1) HSP 1 Score: 31.6 bits (70), Expect = 6.0e+02 Identity = 16/22 (72.73%), Postives = 17/22 (77.27%), Query Frame = -3
HSP 2 Score: 105.5 bits (262), Expect = 3.3e-20 Identity = 46/63 (73.02%), Postives = 55/63 (87.30%), Query Frame = -2
BLAST of CU116875 vs. TrEMBL
Match: I1HY32_BRADI (Uncharacterized protein OS=Brachypodium distachyon GN=BRADI_3g06370 PE=3 SV=1) HSP 1 Score: 32.0 bits (71), Expect = 4.6e+02 Identity = 15/35 (42.86%), Postives = 25/35 (71.43%), Query Frame = -3
HSP 2 Score: 105.5 bits (262), Expect = 3.3e-20 Identity = 46/63 (73.02%), Postives = 55/63 (87.30%), Query Frame = -2
BLAST of CU116875 vs. NCBI nr
Match: gi|778689230|ref|XP_011652920.1| (PREDICTED: dephospho-CoA kinase [Cucumis sativus]) HSP 1 Score: 122.9 bits (307), Expect = 2.9e-25 Identity = 57/63 (90.48%), Postives = 60/63 (95.24%), Query Frame = -2
BLAST of CU116875 vs. NCBI nr
Match: gi|700197626|gb|KGN52784.1| (hypothetical protein Csa_4G001520 [Cucumis sativus]) HSP 1 Score: 122.9 bits (307), Expect = 2.9e-25 Identity = 57/63 (90.48%), Postives = 60/63 (95.24%), Query Frame = -2
BLAST of CU116875 vs. NCBI nr
Match: gi|659108756|ref|XP_008454373.1| (PREDICTED: dephospho-CoA kinase domain-containing protein [Cucumis melo]) HSP 1 Score: 122.9 bits (307), Expect = 2.9e-25 Identity = 57/63 (90.48%), Postives = 60/63 (95.24%), Query Frame = -2
BLAST of CU116875 vs. NCBI nr
Match: gi|1009148388|ref|XP_015891911.1| (PREDICTED: dephospho-CoA kinase isoform X3 [Ziziphus jujuba]) HSP 1 Score: 107.8 bits (268), Expect = 9.6e-21 Identity = 48/63 (76.19%), Postives = 56/63 (88.89%), Query Frame = -2
BLAST of CU116875 vs. NCBI nr
Match: gi|1009148386|ref|XP_015891910.1| (PREDICTED: dephospho-CoA kinase isoform X2 [Ziziphus jujuba]) HSP 1 Score: 107.8 bits (268), Expect = 9.6e-21 Identity = 48/63 (76.19%), Postives = 56/63 (88.89%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|