CU116611 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCATATGCATCTCAATAAGTGGTCCAATAACTTCCAAAGTGGGACGAACACTGGACGGTAGTAAGAATACCCTTTCTTGAGATTCTTCAAGATTTAATGAAACAAACAACGTCTTCAAACGTTTGGTCAAACACTTTACAGAAATTCCGCTAATATCAACCGCTTGTCCATCATCAATCATCTTGAGAAGCTGTTTTAAGTCATTCCCAATATCAGGAAAGTCCTTCAG
BLAST of CU116611 vs. TrEMBL
Match: A0A0A0K7U1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G281360 PE=4 SV=1) HSP 1 Score: 150.2 bits (378), Expect = 1.0e-33 Identity = 76/76 (100.00%), Postives = 76/76 (100.00%), Query Frame = -1
BLAST of CU116611 vs. TrEMBL
Match: A0A0B2Q695_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_011560 PE=4 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 2.3e-22 Identity = 54/76 (71.05%), Postives = 66/76 (86.84%), Query Frame = -1
BLAST of CU116611 vs. TrEMBL
Match: I1LD73_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_10G216200 PE=4 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 2.3e-22 Identity = 54/76 (71.05%), Postives = 66/76 (86.84%), Query Frame = -1
BLAST of CU116611 vs. TrEMBL
Match: A0A151U623_CAJCA (Uncharacterized protein KIAA1704 family OS=Cajanus cajan GN=KK1_007420 PE=4 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 1.3e-20 Identity = 51/76 (67.11%), Postives = 64/76 (84.21%), Query Frame = -1
BLAST of CU116611 vs. TrEMBL
Match: B9SLF1_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0686080 PE=4 SV=1) HSP 1 Score: 104.8 bits (260), Expect = 4.9e-20 Identity = 52/76 (68.42%), Postives = 64/76 (84.21%), Query Frame = -1
BLAST of CU116611 vs. NCBI nr
Match: gi|449465354|ref|XP_004150393.1| (PREDICTED: uncharacterized protein LOC101213388 [Cucumis sativus]) HSP 1 Score: 149.4 bits (376), Expect = 2.5e-33 Identity = 76/76 (100.00%), Postives = 76/76 (100.00%), Query Frame = -1
BLAST of CU116611 vs. NCBI nr
Match: gi|700189174|gb|KGN44407.1| (hypothetical protein Csa_7G281360 [Cucumis sativus]) HSP 1 Score: 149.4 bits (376), Expect = 2.5e-33 Identity = 76/76 (100.00%), Postives = 76/76 (100.00%), Query Frame = -1
BLAST of CU116611 vs. NCBI nr
Match: gi|659124015|ref|XP_008461948.1| (PREDICTED: microtubule-associated protein futsch [Cucumis melo]) HSP 1 Score: 140.2 bits (352), Expect = 1.5e-30 Identity = 72/76 (94.74%), Postives = 73/76 (96.05%), Query Frame = -1
BLAST of CU116611 vs. NCBI nr
Match: gi|356535705|ref|XP_003536384.1| (PREDICTED: uncharacterized protein LOC100788598 [Glycine max]) HSP 1 Score: 111.7 bits (278), Expect = 5.7e-22 Identity = 54/76 (71.05%), Postives = 66/76 (86.84%), Query Frame = -1
BLAST of CU116611 vs. NCBI nr
Match: gi|734364103|gb|KHN17086.1| (Hypothetical protein glysoja_011560 [Glycine soja]) HSP 1 Score: 111.7 bits (278), Expect = 5.7e-22 Identity = 54/76 (71.05%), Postives = 66/76 (86.84%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|