CU116340 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGACACGGAGATGTCACCAAGCTCACCTAGTCAACAATATCCCTGAAACTAAGGATCCAGGAGAAGTAATAACTTCGACCACTGTAATCGAGCCTAAAACACCACCTCTAAATTCTTGTGTTTCTTCCACATCGTCTTCATCGACTTCGCCTTCCTTGTCTTCAAATTCAAATATAATCAAGTTTGACGATCTCGAGTTCCCAGATTTCGAGTGGATATGTAGCAATGATACAAGTAATAACAATGACAATGATA
BLAST of CU116340 vs. TrEMBL
Match: A0A0A0L723_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G303630 PE=4 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 3.2e-12 Identity = 40/64 (62.50%), Postives = 40/64 (62.50%), Query Frame = 3
BLAST of CU116340 vs. NCBI nr
Match: gi|449456221|ref|XP_004145848.1| (PREDICTED: protein ODORANT1-like [Cucumis sativus]) HSP 1 Score: 77.4 bits (189), Expect = 1.3e-11 Identity = 40/64 (62.50%), Postives = 40/64 (62.50%), Query Frame = 3
BLAST of CU116340 vs. NCBI nr
Match: gi|659114349|ref|XP_008457024.1| (PREDICTED: protein ODORANT1-like [Cucumis melo]) HSP 1 Score: 61.2 bits (147), Expect = 9.8e-07 Identity = 33/63 (52.38%), Postives = 35/63 (55.56%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|