CU116293 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGACCGGGGAACCATGGATTACGCCAAAAATTCTCCCACTTCGCCTTCTGTTTCTGCAAGCAATCGGCTATCAGGTAACACTGGAAATTTACACTCATTGGAATGCTTCCCCAGTCATAGAGGGAAGAGAATGGTTAGCGACAGTATTCATTCAGCTTTGGCATGTGATGACATCCTCACCGAAATCCTCCTTCGTTTGCCAGAGAAATCTATTTTCAAACTTATTCTCGTGTCCAAAAGATGGCTA
BLAST of CU116293 vs. TrEMBL
Match: A0A0A0LJ78_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G010130 PE=4 SV=1) HSP 1 Score: 148.7 bits (374), Expect = 3.2e-33 Identity = 78/93 (83.87%), Postives = 78/93 (83.87%), Query Frame = 3
BLAST of CU116293 vs. NCBI nr
Match: gi|778666410|ref|XP_004139251.2| (PREDICTED: F-box protein At5g03970 isoform X1 [Cucumis sativus]) HSP 1 Score: 155.2 bits (391), Expect = 4.8e-35 Identity = 78/78 (100.00%), Postives = 78/78 (100.00%), Query Frame = 3
BLAST of CU116293 vs. NCBI nr
Match: gi|700205658|gb|KGN60777.1| (hypothetical protein Csa_2G010130 [Cucumis sativus]) HSP 1 Score: 145.2 bits (365), Expect = 5.0e-32 Identity = 78/93 (83.87%), Postives = 78/93 (83.87%), Query Frame = 3
BLAST of CU116293 vs. NCBI nr
Match: gi|659070719|ref|XP_008456330.1| (PREDICTED: F-box protein At5g03970 [Cucumis melo]) HSP 1 Score: 132.9 bits (333), Expect = 2.6e-28 Identity = 69/78 (88.46%), Postives = 71/78 (91.03%), Query Frame = 3
BLAST of CU116293 vs. NCBI nr
Match: gi|778666414|ref|XP_011648736.1| (PREDICTED: F-box protein At5g03970 isoform X2 [Cucumis sativus]) HSP 1 Score: 77.4 bits (189), Expect = 1.3e-11 Identity = 39/39 (100.00%), Postives = 39/39 (100.00%), Query Frame = 3
BLAST of CU116293 vs. NCBI nr
Match: gi|1009117476|ref|XP_015875340.1| (PREDICTED: F-box protein At5g03970 [Ziziphus jujuba]) HSP 1 Score: 68.2 bits (165), Expect = 7.8e-09 Identity = 32/41 (78.05%), Postives = 36/41 (87.80%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|